snOPY snoRNA Orthological Gene Database

Family: SNORD95

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300332 ----GAGCGGTGATGATGC--CAACATGCCATCTGAG-TACCTGTGCTGA C_porcellus300899 ----GAGCGGTGATGACCCCA--ACATGCCATCTGAATCC-TTGTGCTGA D_novemcinctus300494 ----GAGCGGTGATGATCC--CAACATGCCATCTGAA-TGACCGTGCTGA D_novemcinctus300553 ----GAGCAGTGATGATCT--CAACATGCCATCTGAG-TGACTGTGCTGA E_telfairi300484 ----GAGCGGTGATGATTT--CAACATGCCATCTGAG-CATCCGTGCTGA E_caballus300234 ---GCGGCGGTGATGCACCCA--ACATGCCATCTGAGCGC-CCGTGCTGA E_europaeus300025 ----GTGCGGTGATGATCCCC-AACATGCCATCTGAGCGC-CCTTGCTGA E_europaeus300035 ----GTGTGGTGATGATCGCA--ACATGCTCTATGAGTGT-CCATGCTGA E_europaeus300436 ----GTGTGGTGATGATCCCA--ACATGCCATCTGAGCAC-CCTTGCTGA E_europaeus300562 ----GTGCGGTGATGATCCCC-AACATGCCATCTGAGCGC-CCTTGCTGA E_europaeus300564 ----GTGCAGTGATGATCCC--AACATGCCATCTGAGTGC-CCTTGCTGA F_catus300298 ---GGGGCGGTGATGACCCCA--ACATGCCATCTGAGTGC-CCATGCTGA G_gallus300049 -------------------------------------------------- H_sapiens300556 ------GCGGTGATGACCCCA--ACATGCCATCTGAGTGT-CGGTGCTGA L_africana300342 ----GAGCGGTGATGATTA--CAACATGCCATCTGAG-CATAGGTGCTGA M_mulatta300254 ---AGGGTGGTGATGACCCCA--ACATTCCGTCTGAATGC-CTGTGCTGA M_mulatta300729 ---GGGGCGGTGATGACCCCA--ACATGCCATCTGAGTGC-CGGTGCTGA M_domestica300084 ---GAAGCAATGATGATTTTCTAACATGCCATCTGA--TGCCTATGCTGA M_domestica300085 ----GAGCTTTGATGAACCCT-AACATGCCATCTGACTAA-TCTTGCTGA M_musculus300114 --TACAGATACAA-GACCTCA--ACATGCCATCTAACTGT-GGAGCTGAA M_musculus300930 ----GAGCAATGATGACCCCA--ACATGCCATCTGAGTGG-CTTTGCTGA M_musculus300932 ---CCAACAGTGATGACCACA--ACATGCCATCTGAGTTG-CTTTGCTGA M_lucifugus300102 ---AGGGCAGTGGTGACACCA--ACATGCCATCTCAGTGC-CCGTCCTGG M_lucifugus300593 ---GGGGCGGTGATGACACCA--ACATGCCATCTGAGTGC-CCGTGCTGA O_anatinus302242 ------GCCGTGATGAACTCTTAACATGCCATCTGATTGC-CCTTGCTGA O_anatinus302243 ----GAGCGCTGATGATCACT-AACATGCCATCTGACTGC-CCTTGCTGA O_anatinus302244 GCCAGAGCGATGAAGAGTT-CTAACATGCCATCTGAGCTGCCCCTGCTGA O_anatinus304264 ----CAGATGCGG-GAACTGAGGACATGCCACCTGACTGC-CCTTGCTGA O_cuniculus300022 ---CGGGCGGTGATGAGCCCA--ACAAGCCATCTGAGTAT-CCATGCAGA O_cuniculus300235 ---GGGGCGGTGATGAGCCCA--ACATGCCATCTGAGTAT-CCATGCAGA O_cuniculus300356 ---CGGGCGGTGATGAGCCCA--ACAAGCCATCTGAGTAT-CCATGCAGA O_cuniculus300491 ----GAGCAGTGATGAGCCCA--ACATGCCATCTGAGTGT-GTGCGTGAA O_garnettii300743 ----GAGCGGTGATGACCCTA--ACATGCCATCTGATTGC-CCGTGCTGA P_troglodytes300085 ---TGGGTGGTGATGACCCCA--ACATTCCATCTGAATGC-CTGTGCTGA P_troglodytes300716 ---GGGGCGGTGATGACCCCA--ACATGCCATCTGAGTGT-CGGTGCTGA P_pygmaeus300757 ---GGGGCGGTGATGACCCCA--ACATGCCATCTGAGTGT-CGGTGCTGA R_norvegicus301042 ----GAGCAATGATGACCCCA--ACATGCCATCTGAGTTG-CTTTGCTGA R_norvegicus301043 ---CCAACAGTGATGACCACA--ACATGCCATCTGAGTTG-CTTTGCTGA S_araneus300941 ---GCG-CCGTGATGAGCCCA--ACATGCCATCTGAGCGC-CCGTGCAGA S_tridecemlineatus300227 ------CGGATTATAAAGGCACAAAGAGCTATCTCAGTGC-CAGTGCTGA S_tridecemlineatus300298 ----GAGCGGTGATGACACCA--ACATGCCATCTGAATGCCATGTGCTGA C_familiaris300332 GAACCAGAGG-------CTGTTTCTGAGCTT---------- C_porcellus300899 AAT-CAGAGG-------CTGTTTCTGAGCTG---------- D_novemcinctus300494 GAACCAGAGG-------CTGTTTCTGAGCTG---------- D_novemcinctus300553 GAACCAGAGG-------CTGTTTCTGAGCTG---------- E_telfairi300484 GACCCAGAGG-------CTGTTTCTGAGCTA---------- E_caballus300234 GACCCAGAGG-------CTGTTTCTGAGCCG---------- E_europaeus300025 GAACCAGAG--------CTGTTTCTGAGTTG---------- E_europaeus300035 GAACCAGAGG-------CTGTCCCTGAGCTA---------- E_europaeus300436 GAACCAGAGGAGAAAAAATATATCTATGCCT---------- E_europaeus300562 GAACCAGAGG-------CTGTTTCTGAGTTG---------- E_europaeus300564 GAACCAGAGG-------CTGTTTCTGAGCTG---------- F_catus300298 GACCCAGAGG-------CTGTTTCTGAGCTG---------- G_gallus300049 ----------------------------------------- H_sapiens300556 AATCCAGAGG-------CTGTTTCTGAGC------------ L_africana300342 GACCCAGAGG-------CTGTTTCTGAGCTG---------- M_mulatta300254 AACCCAGAGG-------CGGTTTCTGAACCA---------- M_mulatta300729 AATCCAGAGG-------CTGTTTCTGAGCTG---------- M_domestica300084 ATACA-GAGG-------CTGTTTCTGAGCTT---------- M_domestica300085 AACCCAGAGG-------CTGTTTCTGAGCAA---------- M_musculus300114 AATCCAGAGG-------CTGTTTTTGTACTC---------- M_musculus300930 AATCCAGAGG-------CTGTTTCTGAGCTG---------- M_musculus300932 AATCCAGAGG-------CTGTTTCTGAGCTG---------- M_lucifugus300102 AAACCAGAGG-------CTGCTGCTGCTG------------ M_lucifugus300593 GAACCAGAGG-------CTGTTTCTGAGCTG---------- O_anatinus302242 AACCCAGAGG-------CTGTTTCTGAGCAT---------- O_anatinus302243 AATCCAGAGG-------CTGTTTCTGAGCATCTGCCTGGCG O_anatinus302244 GACCAAGAGG-------CTGTTTCTGAGCTC---------- O_anatinus304264 AATCCAGAGG-------CTGTTTCTGAGCAT---------- O_cuniculus300022 AAAAGTAGAG-------CTCCAGTCAGACCG---------- O_cuniculus300235 AATCCAGAGG-------CTGTTTCTGAGCTG---------- O_cuniculus300356 AAAAGTAGAG-------CTCCAGTCAGACCG---------- O_cuniculus300491 AACCCGGAGA-------CTGTTTCTCAGCTG---------- O_garnettii300743 AATCCAGAGG-------CTGTTTCTGAGCTG---------- P_troglodytes300085 AACCCAGAGG-------CTGTTTCTGAACCA---------- P_troglodytes300716 AATCCAGAGG-------CTGTTTCTGAGCTG---------- P_pygmaeus300757 AATCCAGAGG-------CTGTTTCTGAGCTG---------- R_norvegicus301042 AATCCAGAGG-------CTGTTTCTGAGCTG---------- R_norvegicus301043 AATCCAGAGG-------CTGTTTCTGAGCTG---------- S_araneus300941 GACCCAGAGG-------CTGTTTCTGAGCCG---------- S_tridecemlineatus300227 AAACCAGAGG-------CTGTTAAAAAGGGG---------- S_tridecemlineatus300298 AAAACAGAGG-------CTGTTTCTGAGCTG----------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved