snOPY snoRNA Orthological Gene Database

Family: SNORD95

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300121 -------ATGGCATGTATTTAATGCGGGTGGATGATT-TTAGTTCAGCC- C_familiaris300041 --------TGGTCCATCCTAATCCCTGCCAGTCGGCC-TGTGGCCTGCC- C_familiaris300159 --------TGATTTGGCCTAATCCCCACTGGTCAGCC-TGTGGCCTTCT- C_familiaris300361 --------TTGTCCGTCCCGATCTCTGCCTGTCTG-C-TGTGGCCCACC- C_familiaris300461 --------GGGTCCATCCTAATCCCTGCGGGTCCTCC-TGTGGCCCGCC- C_porcellus300325 --------TGGCCCATTCTAACTCCTCCTTGTCAGCC-TATGGCTTGCC- C_porcellus300594 --------TGGCCCATTCTAACTCCTCCTTGTCAGCC-TATGGCTTGCC- C_porcellus300891 --------TGGTCCATTCTAATTCCTGCTGGTCAGGC-TGTGGCCTGCC- D_novemcinctus300512 --------GGGTCCATTCTAATCCCTGCTGGCCAGCC-TGTGGCCTGCC- D_melanogaster300130 --------AGGTCCAATCTAATTCT--GCATGGTGGT-TTAATTATG--- D_melanogaster300131 --------GGGTCCAATCTAATTCT--GCATAGTGGT-TTAATTATG--- D_melanogaster300132 --------TAGTCCAATCTAATTCT--GCATCATGGT-TTATTTATG--- D_melanogaster300133 --------TGGTCTACTCTAATGCTTGGCATTGTACT-ACCAAAATGCC- E_telfairi300281 --------CAGTCCATCCTAATCCCTGCTGGCCAGGC-CGTGGCCCACA- E_telfairi300683 --------CAGTCCATCCTAATCCCTGCTGGCCAGGC-CGTGGCCCACC- E_caballus300143 --------CAGTCCATCCTAATTCCTGCCGGTCAGCC-TGTGGCCTGCC- E_europaeus300019 --------GGCTCTATACTAATCCTTTTTGGCTGGCC-TGTGGTCTCC-- F_catus300155 --------CGGTCCACCCTAACCCCTGCCAGTCAGCC-TGTGGCCTGCC- F_catus300224 --------TGGCCCATCCTAATCCCCGCCAGTCTGCC-TGGGGCCTGCC- F_catus300323 --------TGGTCCATCCTAATCCCTGCCGGTCAGCC-TGTGGCCTGCC- H_sapiens300730 --------TGGTCCATCCTAATCCCTGCCGGTCCATC-TGTGGCCTGCC- M_mulatta300643 --------TGGTCCATCCTAATCCCTGCTGGTCCGTC-TGTGGCCTGCC- M_mulatta300644 --------TGGTCCATCCTAATCCCTGCTGGTCCGTC-TGTGGCCTGCC- M_murinus300051 --------TGATCTATCCTAATCC-TGCTGGCCAGCC-TATGGCCTGCC- M_murinus300211 ---------------GTCACACCCCTGTTTTTTTGGC--ATCCTCAGCCC M_domestica300037 --------CTGTCCATCCTAATTCCTGCTGGTCGCTC-CTGTACCTGCC- M_musculus300323 TGTTTTAGCAGAACATCCTTTCACCTG-TGTCTA--C-TTCATTGAAAT- M_musculus300768 --------TGGTCCATCCTAATACCTGCTGGTCAGCC-AGTGATCTGCC- O_anatinus304130 --------CCGTCCATCCTAATGCCCGCTGGCCGACCGCCGTGCCTGCC- O_anatinus304175 --------CCGTCCATCATAATGACCGCTGGCCGACCGCCGTGCCTGCC- O_cuniculus300027 --------GGGTCCATCCTAATCCCTGCCGGCCGGCT-CGTGGCCCGCC- O_garnettii300683 --------TGGTCCATCCTAATTCCTGCTGGCCC-CC-AGTGGCTTGCC- P_troglodytes300656 --------TGGTCCATCCTAATCCCTGCGGGTCCATC-TGTGGCCTGCC- P_pygmaeus300731 --------TGGTCCATCCTAATCCCTGCTGGTCCGTC-TATGGCCTGCC- R_norvegicus300226 --TGGTAACAGCTCAATCTTATAAAAA-TTTACAGCC-ACTATGGAAATC R_norvegicus300472 --------------ATAATAATCAAAA-TGGTCAGTC-CGTGATCTGCC- R_norvegicus300932 -----------------TGGTTATGGC-TGATCAGCC-CGTGATCTGCC- R_norvegicus301093 --------TGGTCCATCCTAATCCCTGCTGGTCAGCC-CGTGATCTGCC- S_araneus300134 --------AGGTGCATCCTAATCCCTGCTGGCTAGCC-AGTGGCCTGG-- S_araneus300307 --------AGGTCCATCCTAATCCCTGCTGGCTAGCC-AGTGGCCTG--- S_araneus300317 --------AGGTCCATCCTAATCCCTGCTGGCTAGCC-AGTGGCCTGG-- S_araneus300865 --------AAGTACGTCCTAATCCCTGCTGGCTAGCC-AGTGGCCTGG-- S_tridecemlineatus300249 ---------TGTCCATCCTAATTCCTGCTGGTCAA-C-TATGGCCTGCC- C_elegans300121 -------GTTTAGCTT-GCATGC----AAAATTATTTTCTA-TTGAAGAT C_familiaris300041 -----AGGTTTCATTT-GTGGCC----CAGAATATTCTAGA-AGCCTTAC C_familiaris300159 -----GAGTTTCACCT-CAGGAC----CAGATCACTCTAGA-AGCCTTAC C_familiaris300361 -----AGGTTGCACCT-GTGGGCA---CGGAGCACTCTGGA-AGCCTCAC C_familiaris300461 -----AGGTTTCGCTT-GTGGAC----CAGAGCACTCCAGA-A-GCCTCA C_porcellus300325 -----AGGTTTTGCTT-GTGGAC----CACAGCACCGTCGA-AACTTGTC C_porcellus300594 -----AGGTTTTGCTT-GTGGAC----CACAGCACCGTCGA-AACTTGTC C_porcellus300891 -----AGGTTTCGCTT-GTGGAC----CACAGCACTCTGGA-AGCTTGAC D_novemcinctus300512 -----AGGCTTCGCTT-GTGGAC----CAGAGCACCCTAGA-AGCCTGCC D_melanogaster300130 -----TAGTCTCGCTT-TTGGAC----CAGATTAATTTCCA--TCCTTTA D_melanogaster300131 -----TAGTCTCGCTT-TTGGAC----CAGAACAATCACCA--TCCTTTA D_melanogaster300132 -----TAGTCTCGCTT-TTGGAC----CAGATCAAACTCCAAATCTCTTA D_melanogaster300133 -----TGGCCTCGCTT-GTAGAC----CAGATCGAGAACCACGTTCGGCA E_telfairi300281 -----AGGGTTCGCTT-GTGGAC----CACATCACCCTAGG-AAGCCTTG E_telfairi300683 -----AGGGTTCGCTT-GTGGAC----CAGATCACCCTAGG-A-GCCTTG E_caballus300143 -----AGGTTTCGCTT-GTGGAC----CAGAGCACCCTAGG-AGCCTCAC E_europaeus300019 -----AGGATTTGCTT-GTGGAC----CAGAGCACCCAAGA-AGTCCCAC F_catus300155 -----AGGTTTCGCTT-GTGGAC----CAGAGTTCTTTAGA-AGCCTCAC F_catus300224 -----AGGTTTTGCTC-GTGCAC----CAGAGAGCTGTAGA-AGCCTCCC F_catus300323 -----AGGTTTCGCTT-GTGGAC----CAGAGCACTCGAGA-A-GCCTCA H_sapiens300730 -----AGGTTTCGCTT-GTGGAC----CAGAGCACCCTAGA-AGCCT-CA M_mulatta300643 -----AGGTTTCGCTT-GTGGAC----CAGAGCACCCTAGA-AGCCT-CA M_mulatta300644 -----AGGTTTCGCTT-GTGGAC----CAGAGCACCCTAGA-AGCCT-CA M_murinus300051 -----AGGTTTCACT--GTGGAC----CATAGCGCCCTGGC-AGCCT-CA M_murinus300211 -----AGAAATAGAAACAAGAGCCCAGCGGAACACCCTAGA-AGCCTCAC M_domestica300037 -----AGGCTTCGCTG-GTGGAC----CAGAGTATCTCGGA-G-ACTCTC M_musculus300323 ----GTTCCTTCACTA-GTGAAC----CAGAGTATTCTAGA-AAACCTGC M_musculus300768 -----AGGCTTCGCTT-GTGGAC----CAGAGCATCCTAGA-AACACTGC O_anatinus304130 -----GGGTTTCGCTT-GTGGAC----CAGAGCAACCCCA----CCGGCC O_anatinus304175 -----GGGTTTCGCTTTGTGGAC----ACAAGCAACCCCCA-C-CCGGCC O_cuniculus300027 -----AGGGTTCGCTT-GTGGAC----CAGAGCAGGGCGGA-G--CGGCG O_garnettii300683 -----AGGTTTCGCTT-GTGGAC----TAGAGCATCCTAGA-AGCTT-CA P_troglodytes300656 -----AGGTTTCGCTT-GTGGAC----TAGAGCACCTTAGA-AGCCT-CA P_pygmaeus300731 -----AGGTTTCGCTT-GTGGAC----CAGAGCACCCTAGA-AGCCT-CA R_norvegicus300226 AATAGGGCAGTTTGTT-GTGGAC----CAGAGCATCCTAGA-AACCTTGC R_norvegicus300472 -----AGGTTTCACCT-GTGGAC----CAGAGCATCCTAGA-AACCCTGC R_norvegicus300932 -----AGGCTTTGCTT-GTGGAC----CAGAGCATCCTAGA-AACCTCGC R_norvegicus301093 -----AGGCTTCGCTT-GTGGAC----CAGAGCATCCTAGA-AACCCTGC S_araneus300134 -----AGGGTTCGCTT-GTGGAC----CAGAGCACCCTGGA-C-GCCCTC S_araneus300307 -----AGGGTTCGCTT-GTAGAC----CAGAGCACCCTGGA-C-ACCCAC S_araneus300317 -----AGGGTTCACTT-GTGGAC----CAGAGCACCCTGAA-C-GCCCTC S_araneus300865 -----AGGGCTCGCTT-GTGAAC----CAGAGCGCCCTGGA---ACCCTC S_tridecemlineatus300249 -----AGGTTTCGCTT-GTGGAC----TACAGCACTGTAGA-AGCCTGAC * * C_elegans300121 TTTATTCGCTGCACTCGGTCATATTCGAGTCTATGATTTTTCTGAAATTG C_familiaris300041 CTAGAGGAGTGAGCAAGGCTTCAGT--GGGCTTGTACCAGAGGTGCTTCT C_familiaris300159 CCAGAGAAGTGAGCAGAGCTTCAGT--AGGATTGTGCCAGAGGTGCTTCT C_familiaris300361 CCAAA--GAAGTGAGCAGGGCTGCAGTGGGCTTGTGCCAGGGGCGCTTCA C_familiaris300461 CCCAGGACAGCGGGCAGGCTTCAG--TGGCTCGTGCCAGGGATGCTTCTG C_porcellus300325 CCAGAT-GAATGAACAAGGCCTCTTGTGGGCTCATGCTACAGGAACTTCT C_porcellus300594 CCAGAT-GAATGAACAAGGCCTCTTGTGGGCTCATGCTACAGGAACTTCT C_porcellus300891 TCAAAA-GAATGAGCACAGGCCCTCATGGGCTTATGTTGGAGGCACTTCT D_novemcinctus300512 TTAGAGGAGTGAGCTGGC-TGCAGTGGGCTCACACTGCGGGTGCTTCT-- D_melanogaster300130 TTATCCTTGTGCTTGTAAT-ATTGCTTAGTTCAATGCACATGAGAAACGT D_melanogaster300131 TTATCCTTGTGCTTGTGAC-AATA-TCAGTCTAATGCACACGAGAAACGT D_melanogaster300132 TTATCCTTGTGCTAGTGACCACTTAACTGTCCTATGCACACGAGAAACGT D_melanogaster300133 CTCGGATTAACCCAAGAATTGAGCTTCGAAATAGCTCTTTTCTTCCTTCT E_telfairi300281 CCCAGCGAATTGGTCAGACTATTG-TGGCCTCACTCCGTGGGCATGCTCC E_telfairi300683 CCCAGCGGATCGGTCAGACTTTTGGTGGCCTCACTCCATGGGCATGCTCC E_caballus300143 CCAGAGGAGCTGGCAGGGCTTCAGTAGGCTCATGCCACGGGCGCTTCT-- E_europaeus300019 CCACCA-----GTAAGGGCCTCTGTAACCCCTTG---CATGAGTGATTCT F_catus300155 CCAGAGGGGCGAGCAAGGCCTCAGT--GGCTTTGTGCCAG-GCTGCTTCT F_catus300224 CCAGA------AAAGTGAACAGACAGCGTGCCTGTGCCCGGGGCACTTCT F_catus300323 CCCAGAGAAGTGAGCAGGCTTCAG-TGGGCTTGTGCCGGGGATGC-TTCT H_sapiens300730 CCCGAGGAGTGAGCAGGGCTCCAGTGGGCTCACGTCATGGGCACTTCT-- M_mulatta300643 CCTGAGGAGTGAGCAGGGCTCCAGTGGGCTCATGTCATGGGCGCTTCT-- M_mulatta300644 CCCAAGGAGTGAGCAGGGCTCCAGTGGGCTCATGTCATGGGCGCTTCT-- M_murinus300051 TCCAAGGAGTGAGCAAG---------GGCTCATATCCTGGGAGCTTCTCC M_murinus300211 CCAAGA-AGTGAGCAGGGTTTCAGTTAGCCCATGT--CATGGGTGCTTCT M_domestica300037 CCGGTGCCG-CGCCGCCGCAGTGGCCGG--CAG--CCAGCCAGGGTCTCT M_musculus300323 CAGAGT-----GAGGCCATTTTATTTTAGGCTTGTGCCCACAGCACTTCT M_musculus300768 CAGAGTTGTGCAAGGCCTTTTCATTTTAGGCTTGTGCCTGCAGCGCTTCA O_anatinus304130 CAGGGACGG-TGTTTCCGCGGGGAGACGT--------------------- O_anatinus304175 CAGGGACGGGTGATTC---------------------------------- O_cuniculus300027 CGGGCGCCGGCGTCGGGGTCGGCGTCGGGGCGGTCCCGGGCGGGCGCTCC O_garnettii300683 CCCAAAGAGTGAGCAGGGATTCAGTTGGCTCATGTCATT-GTGCTTCT-- P_troglodytes300656 CACGAGGAGTGAGCAGGGCTCCAGTGGGCTCACGTCATGAGCGCTTCT-- P_pygmaeus300731 CCCGAGGAGTGAGCAGGGCTCCGGTGGGCTCACGTCATGGGCGCTTCT-- R_norvegicus300226 CAGAGTTGTGCAAGGCCTTTTTGTTTAAGGTTTGTGCCTGCAGCGCTTCT R_norvegicus300472 CAGAGTTGTGTAAGACCTTTTTGTTTTAGGCTTGTGCCGACAGCACTTCT R_norvegicus300932 CAGAGTTGCGCAAGGCCTTTTTGTTTTACGCTTGTGCCAGCAGCACTTCT R_norvegicus301093 CAGAGTTGTGCGAGGCCTTTTTGTGT---GCTTGTGCCGGCAGCGCTTCT S_araneus300134 CCAGGAAGACCAGGCT-GCTGTGTCCTGGCCTG----GGGCTGGGTTCCT S_araneus300307 CCAGGAAGACCGGGCT-GCTGTGCCCTGGCCTG----GGGGTGAGTTTCT S_araneus300317 CCAGGAAGACCGGGCT-ACTGTGTCCTGGCCTG----GGGCTGGGTTTCT S_araneus300865 TTAGGAAGACCGAGCTTGCTTTGTCCTGGCCTG----GGGGTGGGTTTCT S_tridecemlineatus300249 CTGAGT-GGGTGAGCAAGGCCT-TCAAGGGCTCATGCCGGGGATGCTTCT C_elegans300121 GTACATTT--------- C_familiaris300041 AGACACTC--------- C_familiaris300159 AGATCTCG--------- C_familiaris300361 GGAAACAC--------- C_familiaris300461 GACAGTC---------- C_porcellus300325 GGACACTT--------- C_porcellus300594 GGACACTT--------- C_porcellus300891 GGACACTT--------- D_novemcinctus300512 AGACATGC--------- D_melanogaster300130 AAAGGAACACTA----- D_melanogaster300131 AAAAGAACATTA----- D_melanogaster300132 AAAAGAACACTT----- D_melanogaster300133 AGTGACACAG------- E_telfairi300281 CAGGACAGC-------- E_telfairi300683 CAGGACAGC-------- E_caballus300143 AGACATTC--------- E_europaeus300019 AGACACTC--------- F_catus300155 AGGCACTC--------- F_catus300224 GGATACCC--------- F_catus300323 AGACATTC--------- H_sapiens300730 AGACACTC--------- M_mulatta300643 AGACACTC--------- M_mulatta300644 AGACACTC--------- M_murinus300051 AGACATGC--------- M_murinus300211 AGACATTA--------- M_domestica300037 AAACACTC--------- M_musculus300323 GAACATGC--------- M_musculus300768 GAACACCC--------- O_anatinus304130 ----------------- O_anatinus304175 ----------------- O_cuniculus300027 TACAGCTCCGCTCCCGC O_garnettii300683 AGACACTC--------- P_troglodytes300656 AGACACTC--------- P_pygmaeus300731 AGACACTC--------- R_norvegicus300226 GAACACGC--------- R_norvegicus300472 GAACATGC--------- R_norvegicus300932 GAACATAC--------- R_norvegicus301093 GAACACGC--------- S_araneus300134 GGACATTC--------- S_araneus300307 GGACATCG--------- S_araneus300317 GGACATTC--------- S_araneus300865 GGACATCG--------- S_tridecemlineatus300249 GGACACTG---------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved