snOPY snoRNA Orthological Gene Database

Family: SNORD93

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300220 TGGCCGAGGATGAGAAATC-TAATCTGATTGGATATGCTTC-------T- C_porcellus300509 TGGCCAAAGATGAGAACTC-TAACCTGAATGGCTGTGTTC--------TG E_telfairi300371 TGGCCAAGGATGAGAACTCTTAATCTGATTGGGCATGCTTT-------TG E_caballus300056 TGGCCAAGGATGAGAACTC-TAATCTGATTGGATATGCTTC-------TG E_europaeus300243 TGGCCAAGGATGAGAACTCT-AATCTGAT----TGGATTT---------A H_sapiens300349 TGGCCAAGGATGAGAACTC-TAATCTGATTTTATGTGCTTC-------TG L_africana300350 TGGCCAAGGATGAGAACTCTTAATCTGATTGGGCATGCTT-------GTG M_mulatta300172 TGGCCAAGGATGAGAACTC-TAATCTGATTTCATATGCTTC-------TG M_murinus300403 TGGCCAAGGATGAGAACTC-TAATCTGATTGAATTC------------TG M_domestica300047 TGGCCAAGGATGAAAA-CCACAGTCTGATTGGGCATGCTTTCC----ATG M_musculus300194 TGGCCAAGGATGAGAACTC-TAACCTGACTGGATACGC----------TG M_musculus300572 TGGCCAAGGATGAGAACTC-TAACCTGACAGGATACGC----------TG O_anatinus303662 TGACCGAGGATGAAAA-TCATAATCTGATTGGGCATATCTCACTAATATG O_anatinus303663 TGGCCGAGGATGAAAA-TCATAATCTGATTGGGCATATCTCAGTAATGTG O_anatinus304522 TGGCCGAGGATGAAAA-TCATAATCTGATTGGGCATATCTCAGTAATGTG O_anatinus304523 TGACCGAGGATGAAAA-TCATAATCTGATTGGGCATATCTCACTAATATG O_garnettii300006 TGGCCAAGGATGAGAACTC-TAATCTGATTGGA-----TTC-------TG P_troglodytes300167 TGGCCAAGGATGAGAACTC-TAATCTGATTTTATGTGCTTC-------TG P_pygmaeus300433 TGGCCAAGGATGAGAACTC-TAATCTGATTTCATGTGCTTC-------TG R_norvegicus300471 TGGCCAAGGATGAGAACTC-TAACCTGACTGGATATGC----------TG R_norvegicus300599 TGGCCAAGGATGAGGACTC-TAACCTGACTGGATATGC----------TG S_araneus300362 TGGCCAAGGATGAGAACTC--AATCTGAT-GGATGTACTTC-------CA S_tridecemlineatus300021 TGGCCAAGGATGAGAACTC-TAACCTGATTGGATATGCTTC-------TG T_belangeri300265 TGGCCAAGGATGAAAATTC-TAATCTGATTTGCTATGCTTC-------TG X_tropicalis300001 TAGCCAATGATGAGGAATGTACTCCTGAATAGAGATGTTACTTC---TTT X_tropicalis300002 TAGCCTATGATGAGGACTGTACACCTGAATGTAGCTATAACATC---TGC X_tropicalis300003 TAGCCATTGATGAGGAATGTACTCCTGAAT--------CACTTC---TGT X_tropicalis300004 TAGCCAGTGATGAGGAATGTACTCCTGAATGTAGA---TAATTG---TGT * ** ***** * **** C_familiaris300220 --CTGATGGCGTTGAAGGATTTAC-CTGAGGCCA C_porcellus300509 CTCTGATGG-GTTAAAGGATTTAC-CTGAGGCCA E_telfairi300371 CTCTGATGG-GTTAAAGGATTTACTCTGAGGCCA E_caballus300056 CTCTGATGG-GTTAAAGGATTTAC-CTGAGGCCA E_europaeus300243 CTCTGATGG-GTTAAAGGATTTAC-CTGAGGCCA H_sapiens300349 CTGTGATGG-ATTAAAGGATTTAC-CTGAGGCCA L_africana300350 CTCTGATGG-GTTAAAGGATTTAC-CTGAGGCCA M_mulatta300172 CTGTGATGG-ATTAAAGGATTTAC-CTGAGGCCA M_murinus300403 CTCTGATGG-GTTAAAGGATTTAC-CTGAGGCCA M_domestica300047 CTCTGATGG-GTTAAAGGATTTAC-CTGAGGCCA M_musculus300194 CTGTGATGG-GTTAAAGGATTTAC-CTGAGGCCA M_musculus300572 CTGTGATGG-GTTAAAGGATTTAC-CTGAGGCCA O_anatinus303662 CTCTGATGG-GTTAAAGGATTTAG-CTGAGGCCA O_anatinus303663 CTCTGATGG-GTTAAAGGATTTAG-CTGAGGCCA O_anatinus304522 CTCTGATGG-GTTAAAGGATTTAG-CTGAGGCCA O_anatinus304523 CTCTGATGG-GTTAAAGGATTTAG-CTGAGGCCA O_garnettii300006 CTCTGATGG-ATTAAAGGATTTAC-CTGAGGCCA P_troglodytes300167 CTGTGATGG-ATTAAAGGATTTAC-CTGAGGCCA P_pygmaeus300433 CTGTGATGG-AT-AAAGGATT-AC-CTGAGGCCA R_norvegicus300471 CTGTGATGG-GTTAAAGGATTTAC-CTGAGGCCA R_norvegicus300599 CTGTGATGG-GTTAAAGGATTTAC-CTGAGGCCA S_araneus300362 CTCTGATGG-GTTAAAGGATTTAC-CTGAGGCCA S_tridecemlineatus300021 CTCTGATGGGGTTAAAGGATTTAC-CTGAGGCCA T_belangeri300265 CTCTGATGG-GTTAAAGGATTTAC-CTGAGGCCA X_tropicalis300001 ATTTGATGT-CTCAAAGGATTTAC-CTGAGGCTA X_tropicalis300002 ATTTGATGT-ATTAAAGGATTTAC-CTGAGGCTA X_tropicalis300003 ATTTGATGT-GCAAAAGGATTTAC-CTGAGGCTA X_tropicalis300004 CTCTGATGC-ACTAAAGGATTTAC-CTGAGGCTA ***** ******* * ******* *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved