snOPY snoRNA Orthological Gene Database

Family: SNORD92

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300401 TGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACT----GAGA C_porcellus300929 TGGTGCTGTGATGATGCTGTAAAATTGTGGTTTTGACTCACT----GAGA D_novemcinctus300585 TGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACC----GAGA E_telfairi300148 CGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCAACTCACT----GAGA E_telfairi300866 CGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCAACTCACT----GAGA E_caballus300377 TGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACT----GAGA E_europaeus300664 TGGTGCAGTGATGATGCCTTAAGATTGTGGTTTCTACTCACT----GAGA H_sapiens300495 TGGTGCTGTGATGATGCCTTAATATTGTGGTTTCGACTCACT----GAGA L_africana300486 TGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACT----GAGA M_mulatta300633 TGGTGCTGTGATGATGCCTTAATATTGTGGTTTCGACTCACT----GAGA M_domestica300127 TAGTGCTGTGATGATACT---AAATTGTGGTTTCAACTTAAC---TGATA M_domestica300128 TTGTGCTATGATGACATTCC---ATAGTGGTTTCATCAAACT----GATA M_musculus300918 TGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACT----GAGA O_cuniculus300480 TGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACT----GAGA O_garnettii300695 TGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACT----GAGA P_troglodytes300594 TGGTGCTGTGATGATGCCTTAATATTGTGGTTTCGACTCACT----GAGA P_pygmaeus300678 TGGTGCTGTGATGATGCCTTAATATTGTGGTTTCGACTCACT----GAGA R_norvegicus300898 TGGTGCTGTGATGACGTCTTAAAACTGTGGTTCTGACTCACTCACTGAGA S_araneus301055 TGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCTCT----GAGT S_tridecemlineatus300286 TGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACT----GAGA T_belangeri300383 CGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACT----GAGA **** ****** * ****** * ** C_familiaris300401 GTAAAATGAGGACCTACAATTCCTTGGCTGTGTCTGAGCACC- C_porcellus300929 GTAAAATGAAGACCTACAATTCCTTGGCTGTGTCTGAGCACC- D_novemcinctus300585 GCAAAATGAGGACCTACAATTCCTTGGCTGTGTCTGAGCACC- E_telfairi300148 GTAAA-TGAAGACTTACAATTCCTTGGCTGTGTCTGAGCACC- E_telfairi300866 GTAAA-TGAAGACTTACAATTCCTTGGCTGTGTCTGAGCACC- E_caballus300377 GTAAAATGAAGACCTACAATTCCTTGGCTGTGTCTGAGCACC- E_europaeus300664 GTAAA-TGAAGACCTACAATTCCTTGGCTGTGTCTGAGCACT- H_sapiens300495 GTAAAATGAGGACCTACAATTCCTTGGCTGTGTCTGAGCACCC L_africana300486 GTAAA-TGAAGACCTACAATTCCTTGGCTGTGTCTGAGCACC- M_mulatta300633 GTAAAATGAGGACCTACAATTCCTTGGCTGTGTCTGAGCACC- M_domestica300127 GTTGAATGAGGACATCTAATTCCTTGGCTGTGTCTGAGCATA- M_domestica300128 ATTTAATGAGAACACTAAATTCCTTGGCTGTATCTGAGCACA- M_musculus300918 GTAACGTGAGGACCTACAGTTCCTTGGCTGTGTCTGAGCACC- O_cuniculus300480 GCAAAATGAAGACCTACAATTCCTTGGCTGTGTCTGAGCACC- O_garnettii300695 GTAAAATGAGGACCTACAATTCCTTGGCTGTGTCTGAGCACC- P_troglodytes300594 GTAAAATGAGGACCTACAATTCCTTGGCTGTGTCTGAGCACC- P_pygmaeus300678 GTAAAATGAGGACCTACAATTCCTTGGCTGTGTCTGAGCACC- R_norvegicus300898 GGAGTGTGAGGACCTACAATTCCTTGGCTGTGTCTGAGCACC- S_araneus301055 ATAAAATGAAGACCTACAATTCCTTGGCTGTGTCTGAGCACT- S_tridecemlineatus300286 GTAAAATGAGGACCTACAATTCCTTGGCTGTGTCTGAGCACC- T_belangeri300383 GTAAAATGAGGACCTACAATTCCTTGGCTGTGTCTGAGCACC- *** ** * ************ ********

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved