snOPY snoRNA Orthological Gene Database

Family: SNORD91

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300322 TCTAGGAGCCAATGATGTTTTTATTCACAA-TGTCTGAACCTGTCTGAAGCATCCCAGTG C_familiaris300323 TAGAAAAGTCCATGATGGTGTTACCCAAC-TTGTC--ATCCTGTCTGAAGCATCTCAGTG C_porcellus300957 CTTAGGAGCCAGTGATGTTTTTATTCATAA-TGTCTGAACCTATCTGAAGCATCGCCATG C_porcellus300958 AAGAGGAGTCAATGATGGTTATAACCCACAATGTCTGAACCTATCTGAAGCATCTTTGTG D_novemcinctus300596 CTTAGAATCCAATTATGTTTTTATGCGAAA-TGTCTGAACCTGTCTGAAACATCTCAGTG D_novemcinctus300597 TAGAGAAGTCAATGATGC-TTTTACCAAAAATGTCTGAACCTGTCTGAAGCATCTCAGTG E_telfairi300701 TAGAGAAGTCAGTGATGGTTTTA-CCCAGAATGTCTGAACCTGTCTGAAGCATCTCAGTG E_caballus300342 CTTAGGAACCGATGATGTTTTTATTCAAAA-TGTCTGAACCTGTCTGAAGCATCCCAATG E_caballus300343 CAGAGAAGTCAATGATGGTTTTACCCAAAAATGTCTGAACCTGTCTGAAGCATCTCAGTG E_europaeus300708 TGTAGGAGCCAATGATGTTTTTTA----------CTGAAAATGTCTGAAGCATCTCAGTG E_europaeus300709 TAGAGAAGTCAATGATGTTTTTACCTAACA-TGTCTGAACCTGTCTGAAGCATCTCAGTG H_sapiens300698 CTTAAGAGCCAATGATGTTTTTATTCAAAA-TGTCTGAACCTGTCTGAAGCATCCCAGTG H_sapiens300699 TAGAGAAGTCAATGATGGTTTTATTCA-TATCGTCTGAACCTGTCTGAAGCATCTCAGTG M_mulatta300713 CTTAAGAGCCAATGATGTTTTTACTCAAAA-TGTCTGAACCTGTCTGAAGCATCCCAGTG M_mulatta300714 TGGAGAAGTCAGTGATGGTTTTATTCA-TGTTGTCTGAACCTGTCTGAAACAT--CGGTG M_murinus300437 CTTAGGCGCCAATGATGCCTTTATTCAAAA-TGTCTGAACCTGTCTGAAGCATCCCAGTG M_murinus300438 CAGAGAAGTCAATGATGGTTTTACCCAAAA-TGTCTGAACCTGTCTGAAGCATCTCAGTG M_domestica300100 TGGAGAAGCCAATGATGGTTTT--GCCAGAATGTCTGAACCTGTCTGAAGCATCTTAGTG M_musculus300935 TAGAGAAGTCAATGATGGTCATG-CCCAAGATGTCTGAACCTGTCTGAAGCATCTTTTTG M_musculus300936 CTTAGGAGCCAATAATGTTTTTATTCAAAA-TGTCTGAACCTGTCTGAAGCATCCCAGTG O_anatinus304443 TGGAGAAGCTAATGATGAGGAAAGCTATAA-TGTCTGAACCTGGCTGAGGCATCTTTGTG O_anatinus304444 TGAAGAAGCCGATGATGACTCGAGCCAAAA-TGTCTGAACCTGTCTGAAGCAT--CGGTG O_anatinus304445 ACCAGAAGCCCGTGATG-TCCTAGCCGTGA-TGTCTGAACCTGGCTGAGGGGACTGTGAA O_anatinus304569 TGGAGAAGCCAGTGATGGTTTTTGGCCAAAATGTCTGAACCTGTCTGAAGCATTTCAGTG O_cuniculus300245 CTTAGGAGCCAATGATGTTTTTATGCAAAA-TGTCTGAACCTGTCTGACGCATCTCAGTG O_cuniculus300246 GAGAGAAGTCAATGATGAGTTTTACCCAAAATGTCTGAACCTGTCTGAAGCATCTTAGTG O_garnettii300753 TAGAGAAGTCAATGATGA-CTTTGA-AAAAATGTCTGAACCTGTCTGAAGCATCTCAGTG P_pygmaeus300768 CTTAAGAGCCAATGATGTTTTTACTCAAAA-TGTCTGAACCTGTCTGAAGCATCCCAGTG R_norvegicus301048 TAGAGAAGTCAATGATGGTTAAG-CCCAAGATGTCTGAACCTGTCTGAAGCATCTTTGTG R_norvegicus301049 CTTAGGAGCCAATGATGTCTTTATCCAAAA-TGTCTGAACCTGTCTGAAGCATCTCAGTG S_araneus301064 AAGAGAAGTCAATGATGGTTTCATCTAACATTGTCTGAACCTGTCTGACGCATCTCAATG * * *** * * * **** C_familiaris300322 ATGCAATCTTTCTGT-GGTGCTGAGGCTTCTCTGCCA C_familiaris300323 ATGCAATCTCTGTG----TTCTGAGACTTCTCTA--- C_porcellus300957 ATGCAACATCTGT-----TACTGAGGCTTCTTTGGCA C_porcellus300958 ATGTAGTCATTCTGT-CATTCTGAGACTTCTTTAAGA D_novemcinctus300596 ATGCAACCTCTGTGT-GGTGCTGAGGATTCTCTGCTC D_novemcinctus300597 ATGCAGTCTCTGTAT-GGTTCTGAGACTTCTCTGAGA E_telfairi300701 ATGCGGCCTCTGTGG---TGCTGAGACTTCTCTGATA E_caballus300342 ATGCAAC-TCTGTGT-GGTGCTGAGGCTTCTTTGCCA E_caballus300343 ATGCAATCTCTGTGT-GGTTCTGAGACTTCTCTGAGA E_europaeus300708 ATGCCAACTCTGTGT-GGTGCTGAGGCTTCTTTGCCA E_europaeus300709 ATGTTATCTGTGTGG---TTCTGAGACTTCTCTGCTA H_sapiens300698 ATGCAACTTCTGTGT-GATACTGAGGCTTTTTTGCCA H_sapiens300699 ATGCAATCTCTGTGT-GGTTCTGAGACTTCTCCA--- M_mulatta300713 ATGCAACCTCTGTGT-GATACTGAGGCTTTTTTGCCA M_mulatta300714 ATGCAATCTCTGGGT-GATTCTGAGACTTCTCTA--- M_murinus300437 ATGCAAACTCTGTAT-GGTGCTGAGGCTTTTCTGCCT M_murinus300438 ATGCAGTCCCCGTGT-GGTTCTGAGACTTCTCTA--- M_domestica300100 ATGCTACATCCATAT-GGCTCTGAGGCCTCTTTCTCT M_musculus300935 ATGTAGTC--TATGT-GGTTCTGAGACTTCTCTA--- M_musculus300936 ATGCA----AAATGT-TGTACTGAGGCTTCTCTGCTA O_anatinus304443 ATGCATTCTCTTTTT-AGCTCTGAGGTTTCTCCATAA O_anatinus304444 ACGCATTCTTTATGG---CTCTGAGGCTTCTCTGAGG O_anatinus304445 GATCAATCCCTTTTT-GGCTCTGAGGCTTCAGGGTGG O_anatinus304569 AAGTT----CCATAC-GGCTCTGAGGCATCTCTGTGG O_cuniculus300245 ATGCATC-TCTATGT-GGTGCTGAGGCTTCTCTGCCA O_cuniculus300246 ATGCCTTTTCTGTGTAGATTCTGAGACTTCTCTGAGA O_garnettii300753 ATGCAAACCTTTTGT-G--TCTGAGACTTCTCTGAGA P_pygmaeus300768 ATGCAACCTCTGTGT-GATACTGAGGCTTTTTTGCCA R_norvegicus301048 ATGCAGTC--TGTGT-GGTTCTGAGACTTCTCTTAAG R_norvegicus301049 ATGCA----CACTGT-TGTGCTGAGGCTTCTCTGCTC S_araneus301064 ATGCAGTGTTTGTG--GTTTCTGAGACTTCTCTGTAT ***** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved