snOPY snoRNA Orthological Gene Database

Family: SNORD89

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300222 ---ACTGAGGAGTGATGACAATAAAAGG-CCGAATTGCAGTGT-GCCCAT C_porcellus300097 ---AATTAGAAATAAATCCG-TGAAGAA-TGATGACACAGTGT-CCTGGT C_porcellus300215 ---GCTGAGGAATGATGACA-CAAAAGG-CCGAATTGCAGTGT-CCCCGT D_novemcinctus300423 ---ACTGAGGAATGATGACAATAAAAGG-CCGAATTGCAGTGCCTCCAAA E_telfairi300633 ---ACTGAGGAATGATGACAATAAAAGG-CCGGATTGCAGTGT-CTCCAT E_telfairi300877 ---ACTGAGGAGTGATGACAATAAAAGG-CCGAATTGCAGTGT-CTCCAT E_caballus300133 ---ACTGGGGAATGATGACAGTAAAAGG-CCGAATTGCAGTGT---CCTC E_europaeus300276 ---ACTGAGGAATGATGACAATAAAAGG-CCGAATTGCAGTGCCCCCAC- F_catus300204 ---ACTGAGGAGTGATGACAATAAAAGG-CCGAATTGCAGTGT-GCCCAT H_sapiens300430 ---ACTGAGGAATGATGACAAGAAAAGG-CCGAATTGCAGTGT-CTCCAT M_mulatta300405 ---ACTGAGGAATGATGACAAGAAAAGG-CCGAATTGCAGTGT-CTCCAT M_murinus300258 ---ACTGAGGAATGATGACACTAAAAGG-CCGAATTGCAGTGT-GTCCAT M_domestica300020 ---ACTGAGGAATGATGACATTAAAAGG-CCGAATTGCAGTGCCTTCCAT M_musculus300543 ---GCTGAGGAGTGATGACA-TAAAAGG-CCGAATTGCAGTGT-CTCCAT O_anatinus304354 ---ACTGAGGAATGATGACAATAAAAGG-CCGAATTGCAGTGC-TTCCAT O_cuniculus300130 ---ACTGAGGAATGATGACAATAAAAGG-CCGAATTGCAGTGT-CTCCGT O_cuniculus300312 ---ACTGAGGAATGATGACAATAAAAGG-CCGAATTGCAGTGT-CTCCGT O_garnettii300566 ---ACTGAGGAATGATGACAATAAAAGG-CCGAATTGCAGTGT-CTCCAT P_troglodytes300281 ---ACTGAGGAATGATGACAAGAAAAGG-CCGAATTGCAGTGT-CTCCAT P_pygmaeus300141 ---ACTGAGGAATGATGACAAGAAAAGG-CCGAATTGCAGTGT-CTCCAT P_pygmaeus300142 ---ACTGAGGAATGATGACAAGAAAAGG-CCGAATTGCAGTGT-CTCCAT R_norvegicus300277 ---GCTGAGGAATGATGACAATAAAAGG-CCGAATTGCAGTGT-CTCCAT S_araneus300175 ---GCCGAGGAATGATGACAATAAAAGG-CCGAATTGCAGTGT--CTCCC S_tridecemlineatus300240 ---ACTGAGGAATGATGACAAGAAAAGG-CCGAATTGCAGTGT-CTCCCT T_nigroviridis300159 ---ACCTGGATGTGATGT-AACAAAAGG-CCGAAT-GAAGCTCCGCCCAC T_nigroviridis300160 CCTGCTGGGAGATGATGTGAACAAAAGG-CCGAATTAAAGCGCTGCCAGC T_belangeri300264 ---GCTGAGGAATGATGACAATAAAAGGGCCGAATTGCAGTGT-GTCCTA * * * ** ** C_familiaris300222 TAGCAGTTTGCTCTCT-GTGGGGTGCACGATGACAAAATCTCCGGAAGCG C_porcellus300097 CTACAGTTTGCTCTC--TGTGGGCACACGATGACAAAACCTCCTGCAGCG C_porcellus300215 CTACAGTTTGCTCTC--TGTGGGCTCACGGTGACAAAACTTCCTGAAGCG D_novemcinctus300423 TTGCAGTTTGCTCTCTATATGGATGCACGATGACAAAATCTCCTGAAGCG E_telfairi300633 AAGCAGTTTGCTCTCTGTGTGGATGCACGATGACAAAACCTCCTGAAGCG E_telfairi300877 A-GCAGTTTGCTCTCTATGTGGATGCACGATGACAAAACCTCCTGAAGCG E_caballus300133 CAGCAGTTTGCTCTCTTGTGGGGTACACGATGACAAAATCTCCTGAAGCG E_europaeus300276 CAGCAGTTTGCTCTCTTTGTGGATGCACGATGACAAAATCTCCTGAAGCG F_catus300204 CAGCAGTTTGCTCTCT-GTGGGGCGCACGATGACAAAATCTCCAGAAGCG H_sapiens300430 CAGCAGTTTGCTCTC--CATGGGCACACGATGACAAAATATCCTGAAGCG M_mulatta300405 CAGCAGTTTGCTCTC--TCTGGGCACACGATGACAAAATTTCCTGAAGCG M_murinus300258 CAGCAGTTTGCTCTCT----GGGCACACGATGACAAAATCTCCTGAAGCG M_domestica300020 AAGCAGTTTGCTCTCTGTATGGA-GCACAATGACAAAGTCTCCAGAAGCG M_musculus300543 CAACAGTTGGCTCTC----TGAGCACACGATGACAAAACCTCCTGAAGCG O_anatinus304354 AAGCAGTTTGCTCTCTACATGGA-GCACAATGACAAAGACTCCTGAAGCG O_cuniculus300130 TAACAGTTGGCTCTC--TGTGGGCACACGATGACAAAATCTCCCGAAGCG O_cuniculus300312 TAACAGTTGGCTCTC--TGTGGGCACACGATGACAAAATCTCCCGAAGCG O_garnettii300566 CAGCAGTTTGCTCTCTGTGTGGGCACACGATGACAAAACCTCCTGAAGCG P_troglodytes300281 CAGCAGTTTGCTCTC--CATGGGCACACGATGACAAAATATCCTGAAGCG P_pygmaeus300141 CAGCAGTTTGCTCTC--TGTGGGCACACGATGACAAAATATCCTGAAGCG P_pygmaeus300142 CAGCAGTTTGCTCTC--TGTGGGCACACGATGACAAAATATCCTGAAGCG R_norvegicus300277 CAACAGTTTGCTCTCCGTGTGGGCACACGATGACAAAACCTCCTGAAGCG S_araneus300175 CAGCAGTTGGCTCTC----TGGGTGCACGATGACAAAACCCCCCGAAGCG S_tridecemlineatus300240 TAGCAGTTTGCTCTC----TGGGTGCACAATGACAAAATCACCTGAAGCG T_nigroviridis300159 AGC-AGACTGTTCACAGTGGGTG-GAGCTGTGACAAAAA---TCGGACTG T_nigroviridis300160 AGCCAGTGTGGGCTTGCTGGG-G-GCGCCATGATAAAA----CCGGACTG T_belangeri300264 TAGCAGTTTGCTCTCT--CTGGGCACACGATGACAAAATCTCCTGAAGCG ** * * * * *** *** * * * C_familiaris300222 AACCACTGGTCTGACCTCAGT----- C_porcellus300097 AAACAGCAGGCTGACCTCAGC----- C_porcellus300215 AAACAGCGCTCTGACCTCAGC----- D_novemcinctus300423 AACCACTGGTCTGACCTCAGT----- E_telfairi300633 AACC-CTAGTCTGACCTCAGT----- E_telfairi300877 ACCC-TTAGTCTGACCTCAGT----- E_caballus300133 AACCACTGGTCTGACCTCAGT----- E_europaeus300276 AACCACTGTCCTGACCTCAGT----- F_catus300204 AATCACTGGTCTGACCTCAGT----- H_sapiens300430 AACCACTAGTCTGACCTCAGT----- M_mulatta300405 AACCACTAGTCTGACCTCAGT----- M_murinus300258 AACTAGTGGTCTGACCTCAGT----- M_domestica300020 TACAACTAGTCTGACCTCAGT----- M_musculus300543 AGTCA-CTGTCTGACCTCAGT----- O_anatinus304354 AACTATTGATCTGACCTCAGT----- O_cuniculus300130 AACCACCGGTCTGACCTCAGT----- O_cuniculus300312 AACCACCGGTCTGACCTCAGT----- O_garnettii300566 ACCCACTGGTCTGACCTCAGT----- P_troglodytes300281 AACCACTAGTCTGACCTCAGT----- P_pygmaeus300141 AACCACTAGTCTGAACTCAGT----- P_pygmaeus300142 AACCACTAGTCTGACCTCAGT----- R_norvegicus300277 AGTCA-CTGTCTGACCTCAGT----- S_araneus300175 AACC-CCATTCTGACCTCGGC----- S_tridecemlineatus300240 ACCTACTGGTCTGACCTCAGT----- T_nigroviridis300159 AAGCGTGT-TCTGATCCGGGT----- T_nigroviridis300160 AAGCGTTCATCTGATCCCACGGCAGA T_belangeri300264 AATCTCTGGTCTGACCTCAGT----- **** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved