snOPY snoRNA Orthological Gene Database

Family: SNORD88

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300054 ----GTTTGTGATGACTGCA-TACGGATCACTGGGCTCTGAATCTCTAT- C_familiaris300033 ------CTTTCCCCATGATG-TTT----CGCTGGGCTCTGACCTCCCCT- C_familiaris300051 -----GGGCCTCCCATGATG-TTCA--GCACTGGGCTCCTATCACCCCT- C_familiaris300052 ------GGGCCCCTGTGATG-TCCA--GCACTGGGCTCTGACCTCCCCT- C_familiaris300053 ------GGACCCCCATGATG-TCCA--GCACTGGGCTCTGACCTCCCCT- C_porcellus300031 ------GGGTCCCTGTGATG-TCCA--GCACTGGGCTCTGA----CCAT- C_porcellus300032 ------GGGCCTCTGTGATG-TCCA--GCACTGGGCTCCGAGCT-CTGT- C_porcellus301031 ----GGACCCCCCCATGATG-TCCA--GCACTGGGCTCTGATC---CAT- C_porcellus301032 ------GGGTCCCTGTGATG-TCCA--GCACTGGGCTCTGA----CCAT- C_porcellus301033 ------GGGCCTCTGTGATG-TCCA--GCACTGGGCTCCGAGCT-CTGT- D_rerio300061 ------ACGCTTCAGTGATG-TTT--AGCACTGGGCTCTGAGTTCATGT- D_novemcinctus300062 ------TTAAAGCCATGATG-TCCA--GCACTGGGCTCCAACCACCCCT- D_novemcinctus300078 ------GCCAGCCCACGATA-TTCA--GTACTGGGCTGCTGTC-TCTGT- D_novemcinctus300081 ------GGGTCCTTGTGATG-TCTA--GCACTGGGCTCTGATCTCCCAT- D_novemcinctus300402 ------CAGCCTCCATGATG-TCCA--GCACTGGGCTCCAACTACCCCT- D_novemcinctus300506 ------CTGCCCCCGTGATG-TCCA--GCACTAGGCTCTGACCACTCCA- E_telfairi300289 ------TTATCCCAATGATG-GCCA--GCACTGGG-TCTGATCACCC--- E_telfairi300341 -----TGGCCCCCCATGATG-TCTA--GCACTGGGCTCCGACTGCCCCT- E_telfairi300352 ------AGACCCCCATGATG--------CACTGGGCTCCAACTGCCCCT- E_telfairi300539 ------TGGCCCCCATGATG-TCTA--GCACTGGGCTCCAATTGCCCCT- E_caballus300189 -----TGTCC-CCCGCAATG-TCCA--GCACTGGCCTCTCACCGCCTGT- E_caballus300190 ------GGGCCCCCGTGATG-TCCA--GCACTGGGCTCCGACCAGCCCT- E_caballus300191 ------GGGCCCCCGTGATG-TCCA--GCACTGGGCTCCGACCGCCCCT- E_caballus300192 ------GGGCTCCCATGATG-TCCA--GCACTGGGCTCCTATCACCCCT- E_europaeus300285 ------GGGCCCCCGTGATG-TCCA--GCACTGGGCTCTGACCACCCCT- E_europaeus300286 ------GGGCCCCCGTGATG-TCCA--GCACTGGGCTCTGACCACCCCT- E_europaeus300382 ------TTGCCCCCGTGATG-TCCA--GCACTGGGCTCTGACCACCCCT- H_sapiens300569 ------GGGACCCCGTGATG-TCCA--GCACTGGGCTCTGACTGCCCCT- H_sapiens300570 ---CCGGGGCCTCCATGATG-TCCA--GCACTGGGCTCCGACTGCCACT- H_sapiens300571 ------GGGCTCCCATGATG-TCCA--GCACTGGGCTCTGATCACCCCT- L_africana300001 ------GGACCCCCATGATG-TCCA--GCACTGGGCTCTGATCACTCCT- L_africana300188 ------GGGGCTCGATGATG-TCCA--GCACTGGGCTCTGACTGACCCT- L_africana300189 ------GGGCCCCCATGATG-TCCA--GCACTGGGCTCTGATCACCCCT- L_africana300198 ------AGCCCCCGATGATG-TCCA--GCACTGAGCTCTGACTGACCCT- M_mulatta300207 ------------CCATGATG-TCCA--GCACTGGGCTGTGATCACTCCG- M_mulatta300304 ------GGGACCCCATGATG-TCCA--GCACTGGGCTCCGACTGCCCCT- M_mulatta300305 -------GGGCACCATGATG-ACCA--GCACTGGGCTCCGACCGCCACT- M_mulatta300306 ------GGGCTCCCATGATG-TCTA--GCACTGGGCTCCGATCACCCCT- M_murinus300114 ----GGACCCCCCCATGATG-TTCA--GCACTGAGCTCTGACTGCCCAT- M_murinus300115 ------GGGCCTCCATGATG-TCCA--GCACTGGGCTCTGATCCCCACT- M_murinus300213 ----GGACACCT--GTGATG-TCTA--GGACTGAGCTCTGACTGCCCAT- M_murinus300214 ------GGGCCTCCATGATG-TCCA--GCACTGGGCTCTGATCCCCACT- M_murinus300256 ------GGGCCTCCATGATG-TCCA--GCACTGGGCTCTGATCCCCACT- M_murinus300257 ------GGGCTCCAATGATG-TCTA--GCACTGGGCTCCGATCACCCCT- M_murinus300341 ------AAGCTCCCATGATG-TCTA--GCACTGGGGTCCAATCACCCCT- M_domestica300015 ------GGGCTCCCATGATG-CCA---GCACTGGGCTCTGAGCCTC--T- M_musculus300748 ------AGGCTCCTGTGATG-TTTA--GCACTGGGCTCCAAACACCCTT- M_musculus300749 ------GGACCCCTCTGATG-TTCA--GCACTGGGCTCTGACCA-TCCT- M_musculus300750 ------GGACCCCCTTGATG-TCCA--GCACTGGGCTCTGACCA-TCCT- M_musculus300751 ------GAACCCCCATGATG-TATATAGCACTGGGCTCTGACCACCAT-- O_anatinus303206 ------GGGTTTCCATGATG-TCTT--GCACTGGGCTCTGA-TCTC--T- O_cuniculus300363 ------GGACCTGTTTGACA-TCCA--GCGCTGGGCTCTGACCACTCCT- O_latipes300016 ------CTTCTCCGCTGATG-TTTT-AGCACTGGGCTCTGAGTCTCCAT- O_garnettii300096 ----GGGACCCCCCATGATG-TCCA--GCACTGGGCTCTCACTACCCAT- P_troglodytes300007 ------GGGCTCCCATGATG-TCCA--GCACTGGGCTCCGATCACCCCT- P_troglodytes300221 ------TACATTCCATGATG-TCCA--GCACTGGGCTCTGATCACTCTG- P_troglodytes300612 ------GGGACCCCGTGATG-TCCA--GCACTGGGCTCTGACTGCCCCT- P_troglodytes300613 ------GGGCCTCCATGATG-TCCA--GCACTGGGCTCCGACTGCCACT- P_pygmaeus300106 ------GGGACCCCGTGATG-TCCA--GCACTGGGCTCCAACTGCCCAT- P_pygmaeus300107 ------GGGCCTCCATGATG-TCCA--GCACTGGGCTCCGACTGCCACT- P_pygmaeus300108 ------GGGCTCCCATGATG-TCCA--GCACTGGGCTCTGATCACGCCT- P_pygmaeus300324 ------------CCATGATG-TCCA--GCACTGGGCTCTGATCACTCTG- P_pygmaeus300416 ------GGGCTCCCATGATG-TCCA--GCACTGGGCTCTGATCACGCCT- R_norvegicus300054 ------CTACTCTTATAATG-TCCA--GCACAGGGTTTTGACCACCCT-- R_norvegicus300534 ------AGGATCCAATGATG-TTTA--GCACTGGGCTCCAAACATCCTT- R_norvegicus300535 ------GGACCCCTGTGATG-TTCA--GCACTGGGCTCTGACCA-TTCT- R_norvegicus301076 ------GGACCCCTGTGATG-TTCA--GCACTGGGCTCTGATCACCCT-- R_norvegicus301077 ------GAACTCCCATGATG-TATA--GCACTGGGCTCTGACCACCAT-- S_cerevisiae300013 -------AATGGAAATGAGGATCCACAGCACTGGGCACTGAGGG------ S_tridecemlineatus300057 ------GGACCCCTGTGATG-TCTA--GCACTGGGCTCTGACCATTCTTT S_tridecemlineatus300058 ----GGGACCCC--ATGATA-TTCA--GCACTGTGCTCTAACTGCCCCT- S_tridecemlineatus300086 AGACCCAATTTCAAATATTG-ATT----TACGGGGTTCTGACCACTCCTT T_nigroviridis300029 ------GCGCTCCCATGATG-ACG--TGCACTGGGCTCCGAGTCAGCGT- T_nigroviridis300030 ------GCTCTCCCATGATG-ACG--TGCACTGGGCTCTGAGTCCACGT- T_nigroviridis300031 ------GCTCTCCGTTGATG-ACG--CGCACTGGGCTCTGAGTCCACGT- T_belangeri300093 ------ATACCCCTACAATG-TCTA--GCACTGGGCTCTGACCACCCT-- T_belangeri300189 ------CCACTCCCACGATG-TCCA--GCACTGGGCTGCAATTACCCAT- T_belangeri300215 ------GGGTCCCCGTGATG-TCCA--GCACTGGGCTCTGACCACCC-T- T_belangeri300216 ------GGGCTCCCGTGATG-TCCA--GCACTGGGCTCCAATTAGCCAT- * C_elegans300054 GAACCGA----TAATATCC----------GTTCTGATA------------ C_familiaris300033 GAGGACA----CGGTGCCC--CT--GGGACCTCTGACACCC---AGGAGT C_familiaris300051 GAGGATG----CAGTGC-C--TCCCAGGACCTTTGACACCT---GGGGAT C_familiaris300052 GAGGACA----CAGTGCCC--CCCAGGGACCTTTGACACCCA--GGGGTT C_familiaris300053 GAGGACA----CAGTGC-C--CCCCAGGACCTTTGACACCT---GGGGAT C_porcellus300031 GAGGACA----TGGTGCCT--CCT-GGGACCTTTGACACCTA--GGAGT- C_porcellus300032 GAGGACA----TGGTGCCC--CCC-GGGACCTTTGACACCCG--GGGGT- C_porcellus301031 GAGGATA----CAGTGC-C--CCCCAGGACCTTTGACACCT---GGGGGT C_porcellus301032 GAGGACA----TGGTGCCT--CCT-GGGACCTTTGACACCTA--GGAGT- C_porcellus301033 GAGGACA----TGGTGCCC--CCC-GGGACCTTTGACACCCG--GGGGT- D_rerio300061 GTAGACAA---AAGTGCAGTTTT-----GCTCTTGACATGGCA-GAAC-- D_novemcinctus300062 ATGGACA----CCATGCCC--CCC-AGGACCTTTGACACCC---AGGGGT D_novemcinctus300078 GAGGACA----TGGTGA-C--C-CAGGGACTTTTGACACCT---GAGGTT D_novemcinctus300081 GAGGACA----CAGTGCCT--CCT-GGAACCA---------G--GGAGT- D_novemcinctus300402 AAGGACA----CTGTGCCC--CCT-GAGACCTTTGACACCT---GGGGGT D_novemcinctus300506 GGGGACA----CTGTGCCC--CCT-GGGACCTTTGACACCC---AGGGGT E_telfairi300289 GAGGACA----CAATGC-T--CC--AGAACCTTTAACACCT---GGGGGT E_telfairi300341 GCGGACA----CTGTGCCC--CCC-AGGACCTTTGACACCT---GGGGGT E_telfairi300352 GAGGACA----CTGTACCC--CCC-AGGACCTTTGACACCT---AGGGGT E_telfairi300539 GAGGACA----CTGTGCCC--CCC-AGGACCTTTGACACCT---GGGGGT E_caballus300189 GAGGACA----TGGTGC-C--CTCCGGGCCCTTTGATACCCCGGAGGGCT E_caballus300190 GAGGACA----CGGTGCCC--CCC-GGGACCTTTGACACCTG--GGGGT- E_caballus300191 GAGGACA----CGGTGCAC--CCC-GGGACCTTTGACACCCG--GGGGT- E_caballus300192 GAGGACA----CAGTGC-C--CCCCAGGACCTTTGACACCT---GGGGAT E_europaeus300285 GAGGACA----TGGTGCCC--CCC-GGGACCTTTGACACCC---GGGGGT E_europaeus300286 GAGGACA----TGGTGCCC--CCC-GGGACCTTTGACACCC---GGGGGT E_europaeus300382 GAGGACA----TGGTGCCC--CCC-GGGACCTTTGACACCCC--GGGGGT H_sapiens300569 GAGGACA----CGGTGCAC--CCC-GGGACCTTTGACATCCG--GGGTT- H_sapiens300570 GAGGACA----CGGTGCCC--CCC-GGGACCTTTGACACCCG--GGGGT- H_sapiens300571 GAGGACA----CAGTGC-A--CCCCAGGACCTTTGACACCT---GGGGGT L_africana300001 GAGGACA----CAGTGC-C--CCCCAGGACCTTTGACACCT---GGGGAT L_africana300188 GAGGACA----CTGTGCCC--CC--AGGACCTTTGACACTC---GGGGGT L_africana300189 GAGGACA----CAGTGC-C--CCCCAGGACCTTTGACACCT---GGGGAA L_africana300198 GAGGACA----CTGTGCCC--CCC-AGGACCTTTGACACCC---GGGGGT M_mulatta300207 GAGGACA----CAGCAT-T--CCTCAAGACCTTTGACACCT---GGGGAT M_mulatta300304 GAGGACA----TGGTGCAC--CCC-GGGACCTTTGACACCCA--GGGGT- M_mulatta300305 GAGGACA----CAGTGCCC--CCCCGGGACCTTTGACACCCG--GGGGT- M_mulatta300306 GAGGACA----CAGTGC-A--CCCCAGGACCTTTGACACCT---GGGAGT M_murinus300114 GAGAACA----CTG--CCC--CT---AGACCTTTGCCACCC---AGGAGT M_murinus300115 GAGGACA----CAGTGT-T--CCCCAGGAC-TTTGACACTTG--GCA-GT M_murinus300213 GAGGACA----CTTACCCC--CT---AGACCTTTGTCACCC---AAGCGT M_murinus300214 GAGGACA----CTGTGC-C--CTCTGGGAC-TTTGACACTCA--GGG-GT M_murinus300256 GAGGACA----CTGTGC-C--CTCTGGGAC-TTTGACACTTG--GCA-GT M_murinus300257 GAGGACA----CAGTGC-C--CCCCAGGACCTTTGACACCT---GGGGGT M_murinus300341 GAGGACA----CAGTGT-C--CCCCAAGACTTTTGACACCT---GGGGAT M_domestica300015 GAGGACAAACACGGTGC-C--CCCCAGGCC-TTTGACTCCTG--GGG-GT M_musculus300748 GAGGACA----CAGTGCCC--CTCCAGGACCTTTGACACCT---GGAGAT M_musculus300749 GAGGACA----TGGTGC-C--CCCAGGGACCTTTGACACCC---TGGGGT M_musculus300750 GAAGACA----TGGTGC-C--CCCAGGGACCTTTGACACCC---TGGGGT M_musculus300751 GGTGATA----TGTTGTGC--CTCCAGGACCTTTGACATCC---AGGAGT O_anatinus303206 GAGGACAA---CGGTGC-A--CCCCAGGAC-TTTGACCCTCG--GGGAGT O_cuniculus300363 GAAGACA----CTGTGC-T--CCCTGGGACCTGTGACACTC---AGAGGT O_latipes300016 GAAGA-GG---CTGTGCATCTTC-----GG-CCTGACAAGCCG-AGGTTT O_garnettii300096 GAGGACA----CTGTGCCC--CCCTGGGACCTTTGACACCC---AGGGGT P_troglodytes300007 GAGGACA----CAGTGC-A--CCCCAGGACCTTTGACACCT---GGGGGT P_troglodytes300221 GAGGACA----CAGTTT-T--CCCCAAGACCATGGCTACCT---GGGGAT P_troglodytes300612 GAGGACA----CGGTGCAC--CCT-GGGACCTTTGACATCCG--GGGGT- P_troglodytes300613 GAGGACA----CGGTGCCC--CCC-GGGACCTTTGACACCCG--GGGGT- P_pygmaeus300106 GAGGACA----CGGTGCAC--CCC-GGGACCTTTGACACCCG--GGGGT- P_pygmaeus300107 GAGGACA----CGGTGCCC--CCCCGGGACCTTTGACACCCG--GGGGT- P_pygmaeus300108 GAGGACG----CAGTGC-A--CCCCAGGACCTTTGACACCT---GGGGGT P_pygmaeus300324 GAGGACA----CAGTCT-T--CCCCAAGACCATGGCTACCT---GGGGAT P_pygmaeus300416 GAGGACG----CAGTGC-A--CCCCAGGACCTTTGACACCT---GGGGGT R_norvegicus300054 GAGGACA----TGGTGCCTTGCCCCAAGAACTTTGATTCCA---GAATGA R_norvegicus300534 GAGGACA----CAGTGCCC--CTCCAGGACCTTTGACACCT---GGAGGT R_norvegicus300535 GAGGACA----TGGTGC-C--CCCGGGGACCTTTGACACCC---TGGGGT R_norvegicus301076 GAGGACA----TGGAGC-T--ACCCAGGACCTTTGACACCT---GTGGGT R_norvegicus301077 GGTGACG----TGTTGTGC--CTCCAGGACCTTTGACATCC---TGGAGT S_cerevisiae300013 GGAAACA-----AATATCCTTTCAAATGAGTGACAATGCTTTA-GCGGGC S_tridecemlineatus300057 GAGGATA----AGGTGC-C--CCCCAGGACCTTTGACACCT---GGGGGT S_tridecemlineatus300058 GAAGATA----CAGTGCCA--TCC-AGGACCTTAGACACCT---AGGGAT S_tridecemlineatus300086 GAGAATA----AAGTGCCC--CCCCAGGACCTTTGACACCT---GGGGGT T_nigroviridis300029 GGGGACAA---AAGTGCATCTCT-----GGCCCTGACAAGCCA-GAGCTT T_nigroviridis300030 GGAGACGA---GCGTGCATGTCT-----GGCCCTGACAAGCCA-GATCTT T_nigroviridis300031 GGAGACAA---ACGTGCACGTCT-----GGCCCTGACAAGCCG-GAGCTT T_belangeri300093 GAGAACA----TATTACCC--CCCGGGGGAGTTTGAGGGG---------- T_belangeri300189 GAGGACA----CAGTGC-C--TCCCAGGATCTCTGACACCTT--GGGGGT T_belangeri300215 GAGGACA----TGGTGCCC--CCC-GGGACCTTTGACACCC---GGGGGT T_belangeri300216 GAGGACA----CAGTGCTC--CCCCAGGACCTTTGACACCT---GGGGGT C_elegans300054 ---------------------------- C_familiaris300033 CGGAGAGG-------------------- C_familiaris300051 CTGAGAGGCCC----------------- C_familiaris300052 CTGAGGGGCCC----------------- C_familiaris300053 CTGAGGGGCCC----------------- C_porcellus300031 CTGAGGAGCCC----------------- C_porcellus300032 CTGAGGGGCCC----------------- C_porcellus301031 CTGAAGGGCCC----------------- C_porcellus301032 CTGAGGAGCCC----------------- C_porcellus301033 CTGAGGGGCCC----------------- D_rerio300061 CTGAGAAGTGT----------------- D_novemcinctus300062 CTGAG----------------------- D_novemcinctus300078 TTGAGGGGC------------------- D_novemcinctus300081 CTGAGCAGCCC----------------- D_novemcinctus300402 CTGAGGGGCCC----------------- D_novemcinctus300506 CTGAGGGGCCC----------------- E_telfairi300289 CTAAGAGGGAC----------------- E_telfairi300341 CTGAGGGGCCA----------------- E_telfairi300352 CTGAGGGGCCA----------------- E_telfairi300539 CTGAGGGGCCA----------------- E_caballus300189 CTGAGGGGCCG----------------- E_caballus300190 CTGAGGGGCCC----------------- E_caballus300191 CTGAGGGGCCC----------------- E_caballus300192 CTGAGGAGCCC----------------- E_europaeus300285 CTGAGGGGCCC----------------- E_europaeus300286 CTGAGGGGCCC----------------- E_europaeus300382 CTGAGGGGCCC----------------- H_sapiens300569 CTGAGGGGCCC----------------- H_sapiens300570 CTGAGGGGCCCTGG-------------- H_sapiens300571 CTGAGGGGCCC----------------- L_africana300001 CTGAGGGGCCC----------------- L_africana300188 CTGAGGGCTGC----------------- L_africana300189 CTGAGGGGCCC----------------- L_africana300198 CTGAGGGGCT------------------ M_mulatta300207 CTGAGAGAAAA----------------- M_mulatta300304 CTGAGGGGCCC----------------- M_mulatta300305 CTGAGGGGCCC----------------- M_mulatta300306 CTGAGGGGCCC----------------- M_murinus300114 CTGAGGGGCCC----------------- M_murinus300115 CTGAAAGGCCC----------------- M_murinus300213 CTGAGGGGCCC----------------- M_murinus300214 CTGAGAGGCCC----------------- M_murinus300256 CTGAAAGGCCC----------------- M_murinus300257 CTGAGGGGCCC----------------- M_murinus300341 CTGAGGGGCCC----------------- M_domestica300015 CTGAGGAGCCC----------------- M_musculus300748 CTGAGGACCT------------------ M_musculus300749 CTGAGGGGCCC----------------- M_musculus300750 CTGAGGGGTCC----------------- M_musculus300751 CTGAGGGGTTT----------------- O_anatinus303206 CTGAGGATGCC----------------- O_cuniculus300363 CGGAGGGGGAT----------------- O_latipes300016 CTGAGGAGAAC----------------- O_garnettii300096 CTGAGGGGCCC----------------- P_troglodytes300007 CTGAGGGGCCC----------------- P_troglodytes300221 CTGAGAG--------------------- P_troglodytes300612 CTGAGGGGCCC----------------- P_troglodytes300613 CTGAGGGGCCC----------------- P_pygmaeus300106 CTGAGGGGCCC----------------- P_pygmaeus300107 CTGAGGGGCCC----------------- P_pygmaeus300108 CTGAGGGGCCC----------------- P_pygmaeus300324 CTGAGAGAAAA----------------- P_pygmaeus300416 CTGAGGGGCCC----------------- R_norvegicus300054 CTGGAGGACTG----------------- R_norvegicus300534 CTGAGGACCT------------------ R_norvegicus300535 CTGAGGGGTCC----------------- R_norvegicus301076 CTGAGGGGTCC----------------- R_norvegicus301077 CTGAGGGGTTT----------------- S_cerevisiae300013 CTAGAAAACCCGCGCAACTGATCCATTG S_tridecemlineatus300057 CTGAGGGGTCC----------------- S_tridecemlineatus300058 CTGAGGGCCCC----------------- S_tridecemlineatus300086 CTGAGGGGTCC----------------- T_nigroviridis300029 CTGAGGAGAAA----------------- T_nigroviridis300030 CTGAGGAGAGC----------------- T_nigroviridis300031 CTGAGGAGAAA----------------- T_belangeri300093 ---------------------------- T_belangeri300189 CTGAGGGG-------------------- T_belangeri300215 CTGAGGGGCCC----------------- T_belangeri300216 CTGAGGGGCCC-----------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved