snOPY snoRNA Orthological Gene Database

Family: SNORD87

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300004 -----CGGCTGTGATGATTTCCT-------ATTGCCGTTTACCCGTCTGAGGAAAACCGT C_familiaris300080 ACTGGCACAA-TGATGACTTAAA-TTATTTTTTGCCGTTTACCCAGCTGAGGG----TTT C_porcellus300338 GCTGGCACAA-TGATGACATAAA-TT----TTTGCCGTTTACCCAGCAGAGGG----TTT D_novemcinctus300090 ACTGGCACAA-TGATGACTTAAA-TTACTTTTTGCCGTTTACCCAGCTGAGGGG---TTT E_telfairi300138 ACTGGCACTA-TGATGATTTCCAGTTACTTTTTGCCGTTTACCCATCTGAGAG----TTT E_caballus300011 ACTGGCACAA-TGATGACTTAA-----CTTTTTGCCGTTTACCCAGCTGAGGG----TTT E_europaeus300235 ACTGGCACAA-TGATGACTTAAA-TTACCTTTTGCCGTTTACCCATCTGAGAG----TTT F_catus300128 ACTGGCACAA-TGATGACTTAAA-TTACTTTTTGCCGTTTACCCAGCTGAGGG----TTT H_sapiens300446 ------ACAA-TGATGACTTAAA-TTACTTTTTGCCGTTTACCCAGCTGAGGT----TGT L_africana300380 ACTGGCACAA-TGATGATTTAAA-TTACTTTTTGCCGTTTACCCATCTGAGGG----TTT M_mulatta300436 GCTGGCACAG-TGATGACTTAAA-TTACTTTTTGCCGTTTACCCAGCTGAGGG----TGT M_murinus300252 CCTGGCACAA-TGATGACTTAAA-TTACTTTTTGCCGTTTACCCATCTGAGGG----TGT M_musculus300721 GCTGGCACAA-TGATGACTTAAG-TT----TTTGCCGTTTACCCAGCTGAGTG----TTT O_anatinus302346 ATTGGCATTAATGATGATTTTT-----CTTTTTGCCGTTTACCCGGCTGAGTG----CTT O_anatinus302347 ACTGGTACAG-TCATGATTTTAC----CTTTATGCCGTTTACCCAGCTGAATG----TTT O_cuniculus300204 GCTGGCACAA-TGATGACTTAAA-TTACTTTTTGCCGTTTACCCAGCTGAGGG----TTT O_garnettii300323 GCTGGCACAA-TGATGACTTAAA-TT----TTTGCCGTTTACCCAGCTGAGGG----TAT O_garnettii300503 ------ACAA-TGATGACTTAAA-----TTTTTGCTGTTTACCCAGCTGAGGG----TAT P_troglodytes300073 GCTGGCACAA-TGATGACTTAAA-TTACTTTTTGCCGTTTACCCAGCTGAGGG----TGT P_pygmaeus300274 GCTGGCACAA-TGATGACTTAAA-TTACTTTTTGCCGTTTACCCAGCTGAGGG----TGT R_norvegicus300208 GCTGGCACAA-TGATGACTTATG-TT----TTTGCCGTTTACCCAGCTGAGGG----TTT * **** * *** ******** * ** * C_elegans300004 GCTTGATACAACTT--GGAAAAGGCTGAGCCG----- C_familiaris300080 CTTTGAAGAAATAA--TTTTAAGACTGAGATGCCAGT C_porcellus300338 CTTTGAAGAAATCA--TTTTAAGACTGAGATGCCAGT D_novemcinctus300090 CTTTGAAGAAATAAATCTTTAAGACTGAGATGCCAGT E_telfairi300138 CTTTGAAGAACAT----CTTGAAACTGAGTTGCCAGT E_caballus300011 CTTTGAAGACATAA--TTTTAAGACTGAGATGCCAGT E_europaeus300235 CTTTGAAGAAATTA-CTTCTAAGACTGAGATGCCAGT F_catus300128 CTTTGAAGAAATAA--TTTGAAGACTGAGATGCCAGT H_sapiens300446 CTTTGAAGAAATAA--TTTTAAGACTGAGA------- L_africana300380 CTTTGAAGAAAATA-ATCTTGAAACTGAGGTGTCAGT M_mulatta300436 CTTTGAAGAAATAA--TTTTAAGACTGAGATGCCAGT M_murinus300252 CTTTGAAGAAATAA--TTT-AAGACTGAGTTGCCAGT M_musculus300721 CTTTGAAGAGAGAATCTTAAAAGACTGAGATGCCAGC O_anatinus302346 CTTTGAAGTGGA-----CTTAAATCTGAGATGCCATT O_anatinus302347 CTTTGATTGAAGTT---TTGAAGTCTGAGATGCCAGT O_cuniculus300204 CTTTGAAGAAATTT-CTTC-AAGACTGAGATGCCAGT O_garnettii300323 CTTTGAAGAAATAA--TTTTAAGACTGAGATGCCAGT O_garnettii300503 CTTTGAAGAAACAA--TTTTAAGACTGAGA------- P_troglodytes300073 CTTTGAAGAAATAA--TTTTAAGACTGAGATGCCAGT P_pygmaeus300274 CTTTGAAGAAATAA--TTTTAAGACTGAGATGCCAGT R_norvegicus300208 CTTTGAAGAGAGAATCTTAA--GACTGAGCTGCCAGC **** *****

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved