snOPY snoRNA Orthological Gene Database

Family: SNORD86

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300451 --GATCACAGTGATGGCTGACCAGGGCTCCCTGACCTATACAGACCTCTG C_porcellus300829 --AATCACAGTGATGGCTAATCAGGGTGCCCTGACCCATGCAGACCTCTG D_novemcinctus300581 --GATCACAGTGATGGCTGTCCAGGGCTCCCTGACCTGTGCAGGCCTCTG E_telfairi300033 --TATCACAGTGATGGCTGGCCAGGT-TCCCTGACAGATACATGCCTCTG E_telfairi300090 --TATCACAGTGATGGCTGACCAGGG-CCCCTGACCCATACAGGCCTCTG E_telfairi300143 --ACTCACAGTGATGGCTGACCAGGA-CCCCTGACCCATACAGGCCTCTG E_telfairi300431 --TGCCACAGTGATGGCTGACCAGGG-CCCCTGACCCATACAGGCTTCTG E_telfairi300577 --TGCCACAGTGATGGCTGACCAGGG-CCCCTGACCCATACAGGCTTCTG E_telfairi300630 --ACTCCTTATTAGAA-AACATAAGAGTCCTTGACCCATTCAGGCGCCTG E_telfairi300671 --ACTCACAGTGATGGCTGACCAGGA-CCCCTGACCCATACAGGCCTCTG E_telfairi300863 --AATCACAGTGATGGCTGACCAGGG-TCCCTGACCCATTCAGGCGTCTG E_caballus300257 --GATCACAGTGATGGCTAACCAGGGCTCCCTGACCTATACAGGCCTCTG E_europaeus300600 --AATCATGGTGATGGCTAACCAGGACTCCCTGACCTATACTGATCACTG F_catus300311 --GATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGACCTCTG H_sapiens300477 --GATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTG L_africana300054 --TTTCACAGTGATGTCTGACCAGGGCCCCT-----------GGCCTCTG L_africana300442 --TATCACAGTGATGGCTGACCAGGGC-CCCTGACCTATACAGACCTCTG L_africana300505 --GATCGCAGTGATGGCTGGCCAGG--CCCCTGTCCTACATAGGCCTCTG M_mulatta300528 --GATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTG M_murinus300456 --GATCACAGTGATGGCCAACCAGGGCTCCCTGACCTATACAGGCCTCTG M_musculus300006 ATTTCATCAGAGAACACAAAAGAACATTCTTAAAACTAAATAG--CTCTG M_musculus300489 ----TGCCTTTCAGAA-GA-AGAGGCGGACCTGACCTATACAGGCCTCTG M_musculus300524 GATATTTAAGTCATTTAACATATTTTGTTCTGGACCTATACAGGCCTCTG M_lucifugus300836 --AATCACAGTGATGGCTAACCAGGGCATCCTGACCTATACAGGCCTCTG O_cuniculus300162 --ACTCACAGTGACGGCCGCCCAGGGCTCCCCGACCCACGCAGGCCTCTG O_cuniculus300224 -----AGTTATAAAAGCAATAAAATCCTCCCTGACCTGTGCAGGCCTCTG O_cuniculus300348 --TGTCATGGTGATGGCTGACCAGGGCTCCCTGGCTTTTACAGGCCTCTG O_cuniculus300411 --GATCACAGTGATGGCTGACCAGGGCTCCCTGACCTGTGCAGGCCTCTG O_garnettii300656 --GATCACAGTGATGGCTGCCCAGGGCTCCCTGACCTATACAGCCCTGTG P_troglodytes300722 --GATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTG P_pygmaeus300625 --GATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTG R_norvegicus300951 --GATTACAGTGATGGCTGACCAGGACTACCTGACCTATAGAGGCCTCTA S_tridecemlineatus300311 --GATCACAGTGATGGCTGACCGGGGCTCCCTGACCTATACAGGCCTCTG T_belangeri300338 --GATCACAGTGATGGCTGACCAGGGCTTCCTGACCTATGCAGGCCTCTG * * C_familiaris300451 CTAT----GGGGGTGATG---GCCAGCCCTGGTGTCTGAGTGATT C_porcellus300829 ATAT----GGGGGTGATG---GCCAGTCCTGGTGTCTGAGTGATT D_novemcinctus300581 CCAT----GGGGGTGATGATGGCCAGTCCTGGTGTCTGAGTGATT E_telfairi300033 TTAT----GTGAGTGATG--GGTCAGCCCTGGTGTCTGAGTGATT E_telfairi300090 CTAT----GGGAGTGATG--GGCCAGCCCTGGTGTCTGAGTGATT E_telfairi300143 CTAT----GGGAGTGATG--GGCCAGCCCTGGTGTCTGAGTGATT E_telfairi300431 CTGT----GGGAGTGATA--GGCCAGCCCTGGTGTCTGAGTGATT E_telfairi300577 CTGT----GGGAGTGATG--GGCCAGCCCTGGTGTCTGAGTGATT E_telfairi300630 CTAT----GGGAGTGATG--GGCCAGCCCTGGTGTCTGAGTGATT E_telfairi300671 CTAT----GGGAGTGATG--GGCCAGCCCTGGTGTCTGAGTGATT E_telfairi300863 CTAT----GGGAGTGATG--GGCCAGCCCTGCTGTCTGAGTGGTT E_caballus300257 CTAT----GGGGGTGATG---GCCAGTCCTGGTGTCTGAGTGATT E_europaeus300600 CTATCTATGGGAGTGACG---GCCAGTTCTGGTGTCTGAGTGATT F_catus300311 CTAT----GGGG-TGATG---GCCAGTCCTGGTGTCTGAGTGATT H_sapiens300477 CTAT----GGGGGTGATG---GCCAGTCCTGGTGTCTGAGTGATT L_africana300054 CTAT----GGAGGTGACG---GCCAGTCCCGGTGTCTGAGTGATT L_africana300442 CTAT----GGGGGTGATG---GCCAGTCCTGGTGTCTGAGTGATT L_africana300505 CTCT----GGGGATGATG---GCCAGTCCTGGTGTCTGAGTGATT M_mulatta300528 CTAT----GGGGGTGATG---GCCAGTCCTGGTGTCTGAGTGATT M_murinus300456 CTAT----GGGGGTGATG---GCCAGTCCTGGTGTCTGAGTGATT M_musculus300006 CTAT----GGGGGTGATG---GCCAGTCCTGGTGTCTGAGTGATT M_musculus300489 CTAT----GGGGATGATG--G-CCAGTCCTGGTGTCTGAGTGATT M_musculus300524 CTAT----GGGGGTGATG---TTCAGTCCTGGTGTCTGAGTGATT M_lucifugus300836 CTAT----GGGGGTGATG---GCCTGTCCTGGTGTCTGAGTGATT O_cuniculus300162 CC------GGGGGTGACG----CCAGTCCTGGTGTC--AGTGATT O_cuniculus300224 CTAC----AGGGGTGATG--G-CCGGTCCTGGTGTTTAGGTGATT O_cuniculus300348 CTG-----GGGCCGAACG---GCCAGTGCTGGTGTCTGAGCGATT O_cuniculus300411 CTAT----GGGGGTGATG---GCCAGTCCTGGTGTCTGAGTGATT O_garnettii300656 CTAT----GGGGGTGATG---GCCAGTCCTGGTGTCTGAGTGATT P_troglodytes300722 CTAT----GGGGGTGATG---GCCAGTCCTGGTGTCTGAGTGATT P_pygmaeus300625 CTAT----GGGGGTGATG---GCCAGTCCTGGTGTCTGAGTGATT R_norvegicus300951 CTAT----GGGAGTGATG---GCCAGTCCTAGTGTCTGAGTGATT S_tridecemlineatus300311 CTAT----GGGGGTGATG---GCCAGTCCTGGTGTCTGAGTGATT T_belangeri300338 CTAT----GGGAGTGATG---GCCAGTCCTGGTGTCTGAGTGATT * * * * *** * * **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved