snOPY snoRNA Orthological Gene Database

Family: SNORD83

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300375 -----------------GCCAAATGATGTTT---ATTTGATAGAGGAGCA C_familiaris300376 -----------------GCCACATGATGTT---ATTTCGAGGAGTGAGCG C_porcellus300406 -----------------GTCAAGTGATGTTTTCATTTTGAGAAATGAGTC C_porcellus300626 -----------------GCCACATGATGTTCTGAT-CTGAGACGTGAGCG C_porcellus300820 -----------------GCCAGATGATGT--TC-GTTGGCTGCAGGAGCA C_porcellus300964 -----------------GCCAGATGATGT--TC-GTTGGCTGCAGGAGCA C_intestinalis300019 -----------------GCCACATGATGCTTTT-TTAGATAACAC-AGTG C_savignyi300002 -----------------GCCACATGATGCTTTT-T-AGATACCAT-AGCG C_savignyi300008 -----------------GCCACATGATGCTTTT-T-AGATACCAT-AGCA D_rerio300152 -----------------GCCACATGATGTGATG-T-AGATTGCATTAGCA D_rerio300153 -----------------GCCACATGATGTGACG-T-AGATTGCATTAGCA D_rerio300154 -----------------GCCACATGATGTGATG-T-AGATTGCATTAGCA D_rerio300155 -----------------GCCACATGATGTGATG-T-AGATTGCATTAGCA D_rerio300202 CGTGCATGTAATGATGAAAAACATGGATTAACCGCGTCAGGCATGGCGCC D_novemcinctus300209 -----------------GCCACGTGATGTTTTCGTTTTGAAAAGTGAGCG D_novemcinctus300551 -----------------GCCAAATGATGTTT---GTTTAATATGGGAGCA E_telfairi300557 -----------------GCCACATGATGTTTCT-GTCGGAGAAATGAGCG E_telfairi300753 -----------------GCCAAATGATGTTT---AGTTGATACAGGAGCA E_telfairi300754 -----------------CCTAAATGATGTG-TA-GT-TGGTACAGGAGCA E_caballus300019 -----------------GCCATATGATGTTTTCATTTGGAGAAACGAGCG E_caballus300269 --GCTGTTCAGTGATGAGACTC-TGGAATGA--GCGCTGGGCACAGCGCC E_caballus300353 -----------------GCCAAATGATGTTT---ATTTGATAGAGGAGCA E_europaeus300303 -----------------GCCACATGATGTTTTCACGTTGAGAATTGAGTG E_europaeus300579 -----------------GCCAAATGATGTTTA--TTTTGATGCAGGAGCA E_europaeus300672 --GCTGTCCAGTGGTGAGGCTC-TGGAATGA--GCACTGGGCACAGCGCC E_europaeus300673 --CCTGTTCAGTGATGAGGCTC-TGGAATGT--GCGCTGGGCACAGCGCC F_catus300152 -----------------GCCAAATGATGTTTATATTTTGGGAAGTGAGCA F_catus300231 --GCTGTTCAGTGATGAGGCTC-TGGAATGA--GCGCTGGGCACAGCGCC F_catus300232 --GATCTTTGGCGATGAGGCTC-TGGAAGGA--GCGCTGGGCACATCTCA F_catus300258 -----------------GCCAAATGATGTTT---TTTTGATTCAGGAGCA G_gallus300078 -----------------GCCAAATGATGTCAGC-T-AGATGGCATTAGCA G_gallus300080 -----------------GCCAAATGATGTCAAC-T-GGTTGGCATTAGCA G_aculeatus300120 -----------------GCCACATGATGAGCTC-ATAGATG-CAGCAGCT G_gorilla300840 -----------------GCCAAATGATGTTT---ATTTGAAACAGGAGCA G_gorilla300839 -----------------GCCATATGATGTTTTCTTTTCGAAAGGTGAGCG H_sapiens300684 --GCTGTTCAGTGATGAGGC-C-TGGAATGT--GCGCTGGGCACAGCGCC H_sapiens300685 --GCTGTTCGTTGATGAGGCTC--AGAGTGA--GCGCTGGGTACAGCGCC L_africana300150 -----------------GCCACATGATGTTT-CATATTGAGAAATGAGCG M_mulatta300563 -----------------GCCATATGATGTTTTCTTTTCGAAAGATGAGCG M_mulatta300562 -----------------GCCAAATGATGTTT---ATTTGAAACAGGAGCG M_murinus300142 -----------------GCCATATGATGTTTTTTGTTTGAGAAGTGAGCG M_murinus300462 -----------------GCCAAATGATGCTT---ATGTGATACAGGAGCA M_domestica300086 -----------------GCCACATGATGTGTTC-ATATTAAGATGGAGCA M_domestica300087 -----------------GCCACATGATGTATTT--TCAGAGACATGAGCA M_musculus300857 --GCTGTTCTGTGATGAGGCTC-TGGAATGT--GCGCTGGGCACAGCGCC M_musculus300916 -----------------GCCACATGATGTTTGCAT-TTGGGAAGTGAGCG M_musculus300917 -----------------GCCAAATGATGTAT---GTTTGACATAGGAGCA O_anatinus302684 -----------------GCCACATGATGCAATA-GTCTGAGACGGGAGCG O_anatinus302685 -----------------GCCACATGATGTTTTT-TATCGAGACAG-AGCG O_anatinus303564 -----------------GCCACATGATGAACCC-TGAGACGTCACTAGCA O_latipes300094 -----------------GCCACATGATGACTAG-AGAAGCTGCAGCAGCC O_garnettii300361 -----------------GCCATATGATGTTTTTA--TTGAGAAGTGAGCG O_garnettii300739 -----------------GCCAAATGATGCTTTT-ATCTGATACTGGAGCA P_troglodytes300485 -----------------GCCATATGATGTTTTCTTTTCGAAAGGTGAGCG P_troglodytes300484 -----------------GCCAAATGATGTTT---ATTTGAAACAGGAGCA P_pygmaeus300699 -----------------GCCAAATGATGTTT---ATTTGAAACAGGAGCA P_pygmaeus300700 -----------------GCCATATGATGTTTTCTTTTCGAAAGGTGAGCG R_norvegicus300959 -----------------GCCAAATGATGTGT---GTTTGATATAGGAGCA R_norvegicus300960 -----------------GCCACATGATGTTTGCAA-TTGGGAAGTGAGCG S_araneus300669 -----------------GCCACATGATGTTCGCTTCTTGAGAAATGAGCG S_araneus301015 -----------------GCCAAATTATGTTT----ATTGATACAGGAACA S_tridecemlineatus300250 -----------------GCCAAATGATGTTT---ATTTGATACTGGAGCA S_tridecemlineatus300146 -----------------GCCACATGATGTTTTCATTTCGAGAAGTGAGCG T_nigroviridis300032 --CTCCGTCTGCGATGAGACCA-CGGATCTG--GCGCCGGGCACGGCGCC T_nigroviridis300158 -----------------GCCATGTGATGACTTG-ATTCATGTCAGTAGCT T_belangeri300090 -----------------GCCAAATGATGTTT---ATTTGGTACAGGAGCA T_belangeri300172 -----------------GCCACATGATGTTTGCA--CTGAGAAGTGAGCG T_belangeri300412 -----------------GCCAAATGATGTTT---ATTTGGTACAGGAGCA C_familiaris300375 CTTTAGTGCC--AGGACGACTCTTAATCTATCACCC-ATGACTGATGGCT C_familiaris300376 C-TTTGCGCT--AGGATGACC-TTAATCTATCACCA-GTAACTGATGGCT C_porcellus300406 T-TTTGTGCA--GTGCTGACC-TTAATCACTCATCC-TTGACTGACA--- C_porcellus300626 C-TCTGCGCA--GTGCTGACC-CTGATCTATCACCC-TGGACTGATGGCT C_porcellus300820 C-TTGGTGCG--AGGACGACTGTTTACCTATCACCC-ATGCCTGATGGCT C_porcellus300964 C-TTGGTGCG--AGGACGACTGTTTACCTATCACCC-ATGCCTGATGGCT C_intestinalis300019 T-TA-A-ACA--ATGATGACCTTTTATCTATCACCCATTTACTGATGGCG C_savignyi300002 T-TA-CTGCA--TTGATGACCTTTTATCTATCACCCATTAACTGATGGCA C_savignyi300008 T-TA-CTGCA--TTGATGACCTTTTATCTATCACCCATTAACTGATGGCG D_rerio300152 T-TGC-TGCA--AAGATGACCGTTTATCTATCACCC-ATGACTGATGGCT D_rerio300153 C-ACTGTGCG--AAGATGACCAGTTATCTATCACCC-ATGACTGATGGCT D_rerio300154 C-ACTGTGCA--GAGATGACCAGTTATCTATCACCC-ATGACTGATGGCT D_rerio300155 C-TCTGTGCA--AAGATGACTCGCTATCTATCACCC-AAGACTGATGGCT D_rerio300202 C-GAAACGCAT---GAGGAAATTTCCCATGCTGCCTTCCTTCTGACAGCA D_novemcinctus300209 C-TTTGCGCG--CTGATGACC-TTAATCTATCACCC-TTGACTGATGGCT D_novemcinctus300551 CTTCGGTGCA--GGGACGACTCTTAATCTATCACCC-ATGACTGATGGCT E_telfairi300557 CGTC-GCGCGCCCTGATGACC-GTCATCTATCACCC-TTGGCTGATGGCT E_telfairi300753 CTTTTGTGCA--AAGACGACTCTTAATCTATCACCC-ATGACTGATGGCT E_telfairi300754 CGTGCGTGCA--AGGACGACTCCTAATCTATCACCC-GTGACTGATGGCT E_caballus300019 C-TTTGCGCA--ATGATGACC-TTAATCTATCACCC-TTGACTGATGGCT E_caballus300269 C-GAGTCAGAC--TGCGGAAGCATTCCTAGCTGCCTTCCTTCTGAGAACA E_caballus300353 CTTTAGTGCC--AGGACGACTCTTAATCTATCACCC-ATGACTGATGGCT E_europaeus300303 C-TTTGCACA--ATGATGACT-TAAATCTATCACCC-TTAACTGATGGCT E_europaeus300579 CTTTTGTGCC--AGGACGACTCTA-ATCTATCACCC-ATGACTGATGGCT E_europaeus300672 C-AAGTCAGAC--T--GGAAATATTCTTTGCTGCCTGCCTTCTAAGAACA E_europaeus300673 C-GAGTCAGAC--TGCGGAAATATTCCTTGCTGCCTTCCTTCTGAGAACA F_catus300152 C-TTTGCGCA--ATGATGACC-TTAATCTATCACCC-TTGACTGATGGCT F_catus300231 C-GAGTCCAAC--TGCGGAAACGTTCCTTGCTGCCTTCCTTCTGAGAACA F_catus300232 C-GAGTAAGAT--GGCAGAAACTTTCCTCCCTGCCTTGTCTCTGGGAATA F_catus300258 CTTTAGTGCT--GGGACGACTCTTCATCTATCACCC-ATGACTGATGGCT G_gallus300078 C-TCAGTGCA--AAGATGACC-TTCATCTATCACCC-CATGCTGATGGCT G_gallus300080 C-TCCGTGCA--AAGATGACC-TTCATCTATCACCC-TATGCTGATGGCT G_aculeatus300120 C-TC-GGGCA--GTGATGACCTGCTATCTATCACCC-TTTTCTGATGGCT G_gorilla300840 CCTCAGTGCA--AGGACGACTCTTTATCTATCACCC-ATGACTGATGGCT G_gorilla300839 C-TTTGCGCA--GTGATGACC-CTCATCTATCACCC-TTGACTGATGGCT H_sapiens300684 C-GAGACAGAC--TGCGGAACCGTTCCTTGTTGCCTTCCTTCTGAGAACA H_sapiens300685 C-GAATCGGACAGTGTAGAACCATTCTCTACTGCCTTCCTTCTGAGAACA L_africana300150 C-TTTACGCT--ATGATGACC-TTAATCTATCACCC-TTGACTGATGGCT M_mulatta300563 C-TTTGCGCA--GTGATGACC-CTCATCTATCACCC-TTGACTGATGGCT M_mulatta300562 CCTCAGTGCA--AGGACGACTCTT-ATCTATCACCC-ATGACTGATGGTT M_murinus300142 C-TTTGCGCA--GTGATGACC-TCGATCTATCACCC-TTGACTGATGGCT M_murinus300462 CATCAGTGCA--AGGACGACTTTT-ATCTATCACCC-ATGACTGATGGTT M_domestica300086 CCTTGGTGCC--AGGACGACTTTTGATCTATCACCC-ATGACTGATGGCT M_domestica300087 C-TCAGTGCT--GAGATGACCT-TTATCTATCACCC-TTGACTGATGGCA M_musculus300857 C-GAGAGAGAC--TGAGGAATTATTCCCTGTTGCCTTCCTTCTGAGAACA M_musculus300916 C-TCTGCGCA--GTGCTGACC-CTTATCTATCACCC-TTGACTGATGGCT M_musculus300917 CTTGTGTGCA--AGGACGACCCTT-ATCTATCACCC-ATGACTGATGGCT O_anatinus302684 C-CACGCGCC--AGGACGAC-CTTCATCTATCACCC-TTGACTGATGGCT O_anatinus302685 C-CCTGTGCG--GAGATGACCT-CGATCTATCACCC-TTGACTGATGGTG O_anatinus303564 T-ACCGTGCA--AAGATGACT-CACATCTATCACCC-AAGACTGATGGTT O_latipes300094 T-TC-GGGCC--GTGGCGACCTTTTATCTATCACCC-TTGTCTGATGGCC O_garnettii300361 C-TTTGCGCA--GTGATGACC-TTAATCTATCACCC-TTGACTGATGGCT O_garnettii300739 CTTCAGTGCA--AAGAAGACTCTT-ATCTATCACCC-ATGACTGATGGCT P_troglodytes300485 C-TTTGCGCA--GTGATGACC-CTCATCTATCACCC-TTGACTGATGGCT P_troglodytes300484 CCTCAGTGCA--AGGACGACTCTT-ATCTATCACCC-ATGACTGATGGCT P_pygmaeus300699 CCTCAGTGCA--AGGATGACTCTT-ATCTATCACCC-ATGACTGATGGCT P_pygmaeus300700 C-TTTGCGCA--GTGATGACC-CTCATCTATCACCC-TTGACTGATGGCT R_norvegicus300959 CT-GTGTGCA--AGGACGACCCTC-ATCTATCACCC-ATGACTGATGGCT R_norvegicus300960 C-TCTGCGCGCGGTGCTGACC-CTTATCTATCACCC-TTGACTGATGGCT S_araneus300669 C-TTGGCGCA--ATGCTGACC-ATTATCTATCACCC-TGGACTGATGGCT S_araneus301015 CTTACATGCC--AGGTTGACTCTC-ATCTATCACCC-ATGACCTATGGCT S_tridecemlineatus300250 CTTCGGTGCA--AGGACGACTCTTAATCTATCACCC-ATGACTGATGGCT S_tridecemlineatus300146 C-TTTGCGCA--GTGCTGACC-TTAATCTATCACCC-TTGACTGATGGCT T_nigroviridis300032 C-GACACTCAT---GAGGAAACCTTCCATGCTGCCTTCCTTCTGAGACGG T_nigroviridis300158 G-TCTGGGCT--GTGATGACCTCTGATCTATCACCC-TTTTCTGATGGCT T_belangeri300090 CTTCTGTGCA--AGGACGACTCCTCATCTATCACCC-ATGACTGATGGCT T_belangeri300172 C-TCTGCGCA--GGGATGACC-TTAATCTATCACCC-TTGACTGATGGCT T_belangeri300412 CTTCTGTGCA--AGGACGACTCCTCATCTATCACCC-ATGACTGATGGCT ** * * C_familiaris300375 -- C_familiaris300376 -- C_porcellus300406 -- C_porcellus300626 -- C_porcellus300820 -- C_porcellus300964 -- C_intestinalis300019 -- C_savignyi300002 -- C_savignyi300008 -- D_rerio300152 -- D_rerio300153 -- D_rerio300154 -- D_rerio300155 -- D_rerio300202 CA D_novemcinctus300209 -- D_novemcinctus300551 -- E_telfairi300557 -- E_telfairi300753 -- E_telfairi300754 -- E_caballus300019 -- E_caballus300269 GC E_caballus300353 -- E_europaeus300303 -- E_europaeus300579 -- E_europaeus300672 GC E_europaeus300673 GC F_catus300152 -- F_catus300231 GC F_catus300232 GC F_catus300258 -- G_gallus300078 -- G_gallus300080 -- G_aculeatus300120 -- G_gorilla300840 -- G_gorilla300839 -- H_sapiens300684 GC H_sapiens300685 GC L_africana300150 -- M_mulatta300563 -- M_mulatta300562 -- M_murinus300142 -- M_murinus300462 -- M_domestica300086 -- M_domestica300087 -- M_musculus300857 GC M_musculus300916 -- M_musculus300917 -- O_anatinus302684 -- O_anatinus302685 -- O_anatinus303564 -- O_latipes300094 -- O_garnettii300361 -- O_garnettii300739 -- P_troglodytes300485 -- P_troglodytes300484 -- P_pygmaeus300699 -- P_pygmaeus300700 -- R_norvegicus300959 -- R_norvegicus300960 -- S_araneus300669 -- S_araneus301015 -- S_tridecemlineatus300250 -- S_tridecemlineatus300146 -- T_nigroviridis300032 AC T_nigroviridis300158 -- T_belangeri300090 -- T_belangeri300172 -- T_belangeri300412 --

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved