snOPY snoRNA Orthological Gene Database

Family: SNORD81

CLUSTAL W (1.83) multiple sequence alignment C_elegans300000 ------GTGCAAGGATGAAA-----AA----GAACTCTCTCACTGAT-AGATGATGTCTT C_familiaris300063 CCAAATACATGATGATCTCA-TTGCAACTT-GAACTCTCTCACTGATCATTTGATGATTA C_familiaris300184 CAGAATACATGATGATCTCA-TTGCAACTT-GAACTCTCTCACTGATCATTTGATGATTT C_porcellus300634 TGGAATACATGATGATCTCA-CCTCAGCTT-GAACCCTCTCCCTGTTTACTGGATGATGA C_porcellus300743 CAGAGTACGGGACGGTCACA-CCTCAA-CT-GAAACCT-TCACTGATTACCTGATGATGT D_novemcinctus300013 CAGAATACATGATGATCACA-CCCCAACTT-GAACTCTCTCACTGATTATGTGATGACGA D_novemcinctus300416 CAGAATACATGATGATCACA-CCCCAACTT-GAACTCTCTCACTGATTATGTGATGACGA E_telfairi300155 CAGAATACATGATGATC-CA-CCCCAACTT-GAACTCTCTCACTGATAACTTGATGATA- E_telfairi300559 TTAAATACATGATGATCT-A-CCCCAACTT-GAACTCTCTCACTGATAACTTGATGATAA E_telfairi300792 CACAATATATGACGGTC-CA-TCCCAACTT-GACCTCTCTCACCAGTTACTTGATGATA- E_caballus300089 CAGAATACATGATGATCTCA-CCCCAACTT-GAACTCTCTCACTGATTACTTGATGATGA E_europaeus300146 CAGAATACATGATGATCTCA-----AACTT-GAACTCTCTCACTGATCACTTGATGTTAG G_gallus300099 TGGAACAAATGATGATTAAAACCTTAGCTT-GAACTCTCTCACTGAACA-GAGATGAAAA H_sapiens300197 CAGAATACATGATGATCTCA-ATCCAACTT-GAACTCTCTCACTGATTACTTGATGACAA L_africana300382 CAGAATACATGATGATC-CA-CCCCAACTT-GAACTCTCTTACTGATTACTTGATGATG- M_mulatta300016 TTGGATATATAATAATCTCA-CTCCAACTT-AAACTCTCTCACTGATTATTTGATAATAA M_mulatta300182 CAGAATACATGATGATCTCA-GTCCAGCTT-GAACTCTCTCACTGATTACCTGATGACAA M_mulatta300206 GCAGATAAAATAGGCCTTTAGAACTATTATCCAGGAAT--CACTGATTACTTGATGACAA M_mulatta300342 ----------CACAAAACCA---CCGATAT-CAACTCTCTCACTGATTACATGACAATAA M_mulatta300347 ----------GAGAATGCAA-----GATTT-----TCTCTCACTGATTACTTGATGACAA M_mulatta300369 TTGGATATATGATAATCTCA-CTCCAACTT-TAACTCTCTCACTGATTATTTGATAATAA M_mulatta300393 AAAAATACATGATGATCTCA-CCTCAGTTT-GAACTCTCTCACTGATTACTTGATGACAA M_murinus300016 CAGAATACATGATGATCTCA-CTGCAACTT-GAACTCTCTCACTGATTACTTGATGACAA M_murinus300160 ACAAATCCATGATGATCTCG-CCTCAGTTT-GAACTCTCTCACTGATTACTTGATGACAA M_murinus300338 ACCAATACGTGATGATCACA-CTCCAATTTTGAACTCTCTCACTGATTACTTGATTACAA M_musculus300642 CAGAATACATGATGATCTCA-CAC-AACTT-GAACTCTCTCACTGATTACTTGATGATAG M_musculus300706 CAGGACACATGATGATCTCA-CCCCAACTT-GGACTCTCTCACTGATTACTTGATGACAG M_lucifugus300006 CAGAATACATGATGATCTCA-ACCCAACTT-GAACTCTCTCACTGATTACTTGATGATGA O_anatinus303583 -----CAAATGATGACCACATCCTTAA-TT-GAACTCTCTCACTGATAT-TTGATGAGAA O_anatinus304418 -----CAAATGATGACCACATCCTTAA-TT-GAACTCTCTCACTGATAT-TTGATGAGAA P_troglodytes300172 CAGAATACATGATGATCTCA-ATCCAACTT-GAACTCTCTCACTGATTACTTGATGACAA P_troglodytes300323 -CAAATACATGATGATCTCT-CCTCAGTTT-GAACTCTCTCACTGATCACTTGATGACAA P_troglodytes300395 GAAAATACATGATGATCTCA-CTCCAACTG-GAACTCTCTCACTGATTACTTGATAACAC P_troglodytes300476 TTGGATATACGATAATCTCA-CTCCAACTT-AAACTCTCTCACTGACTATTTGATAATAA P_pygmaeus300124 -CAAATACATGATGATCTCA-CCTCAGTTT-GAACTCTCTCTCTGATTACTTGATGACAA P_pygmaeus300186 GAAAATACATGATGATCTCA-CTCCAACTT-GAACTCTCTCACTGATTACTTGATGACAA P_pygmaeus300454 TTGGATATATGATAATCTCA-CTCCAACTT-AAACTCTCTTGCTGATTATTTGATAATAA P_pygmaeus300577 CAGAATACATGATGATCTCA-ATCCAACTT-GAACTCTCTCACTGATTACTTGATGACAA R_norvegicus300172 CAGAATACATGATGATCTCA-CTCCAACTT-GAACTCTCTCACTGATTACTTGATGAAAG S_araneus300701 CAGAATATATGATGATCTCA-----A-CTT-GAACTCTCTCACTGATGACTTGATGACAG T_belangeri300140 CAGAATATATGATGATCTCA--CCAAACTT-GAACTCTCTCACTGATTACTTGATGACAA * * * ** C_elegans300000 CCTACATTATCAGAGCAC------------ C_familiaris300063 ----A--AAAAAAAAAAAAAG--------- C_familiaris300184 TAAAA--GATCTGATATTCTG--------- C_porcellus300634 GCAAA--GATCTAATGTTCTA--------- C_porcellus300743 GAAAA--GATCTGATATTATA--------- D_novemcinctus300013 TAAAA--GATCTGATATTCTG--------- D_novemcinctus300416 TAAAA--GATCTGATATTCTG--------- E_telfairi300155 -ATGG--GATCTGATATTCTG--------- E_telfairi300559 TGGGA--AGGAAAAAAAAAAGAGTACTTAA E_telfairi300792 -ATCG--GATCTGATATTCTG--------- E_caballus300089 GATAA--GATCTGATATTCAT--------- E_europaeus300146 AAAATAAGATCTGATATTCTG--------- G_gallus300099 CCTAA--GGTCTGAGTTGTTCCA------- H_sapiens300197 TAAAA--TATCTGATATTCTG--------- L_africana300382 -ATAA--GATCTGATATTCTG--------- M_mulatta300016 TAACA--GGTCAGATATTTTG--------- M_mulatta300182 TAAAA--GATCTGATATTCTG--------- M_mulatta300206 TAAAA--TATCTGATATCC----------- M_mulatta300342 AA-----GATCTGATATTCTG--------- M_mulatta300347 TAAAA--GATCTGATATTCTG--------- M_mulatta300369 TAACA--GGTCAGATATCCTG--------- M_mulatta300393 TAAAAA-GATCTGATATTGTG--------- M_murinus300016 CAAAA--GATCTGATATTCTG--------- M_murinus300160 TAAAA--GATCTGATATT------------ M_murinus300338 TAAAA--GATTTGATATTCTT--------- M_musculus300642 TAAAA--GATCTGATGTTCTG--------- M_musculus300706 TAAAA--GACGTGATATTCTG--------- M_lucifugus300006 AAGAA--GATCTGATATTCTG--------- O_anatinus303583 TCTAA--GGTCTGATG-------------- O_anatinus304418 TCTAA--GGTCTGATG-------------- P_troglodytes300172 TAAAA--TATCTGATATTCTG--------- P_troglodytes300323 TAAAA--GATCTGATATTGTG--------- P_troglodytes300395 TAAAA--TATCTGATATTCTG--------- P_troglodytes300476 TA-----GGTCAGATATTCTT--------- P_pygmaeus300124 TAAAA--GATCTGATATTGTG--------- P_pygmaeus300186 TAAAA--TACCTGATATTCTG--------- P_pygmaeus300454 TAACA--GGTCAGATATTCTT--------- P_pygmaeus300577 TAAAA--GATCTGATATTCTG--------- R_norvegicus300172 TAAAA--GATCTGATGTTCTG--------- S_araneus300701 TAAAT--GATCTGATATTCTG--------- T_belangeri300140 TAAAA--GATCTGATATTCTG--------- *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved