snOPY snoRNA Orthological Gene Database

Family: SNORD80,snoRNA:Me28S-G1083

CLUSTAL 2.0.10 multiple sequence alignment D_melanogaster300012 -TTTTAAGTGATGAGCTTTAACTTTCGCCCCTATCTGAAAT-TGAAACTTCTCCTGTTGA D_melanogaster300200 CGTTATC-TGATGAGCAATAACTTTCGCCCCTAGCTGAAAAATGATACTTCTCATGTTGA D_melanogaster300201 -TTAGTTCTGATGAGCATTAACTTTCGCCCCTATCTGAAAT-TGAAACTTCTCTTGTTGA D_melanogaster300202 -ATTATCATGATGAGCATTAACTTTCGCCCCTATCTGAAAT-TGAAACTTCTCATGTTGA * ******** *************** ****** *** ******* ****** D_melanogaster300012 ATGCGAGATTGGTCTTACTGAAATG D_melanogaster300200 ATGCGAGATTGGTCTTACTGAAAAT D_melanogaster300201 ATGCGAGATTGGTCTTACTGAAAAA D_melanogaster300202 ATGCGAGATTGGTCTTACTGAAAAG ***********************

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved