snOPY snoRNA Orthological Gene Database

Family: SNORD80

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300188 -TCAAGTGATGATTAATAATGCATAGTTCAAATGAT---CTCCATGATTACTAT--TCAG A_thaliana300189 -TCAAGTGATGATTGATAACGCATAGTTCAGATGATAAATTCTATTATGATTAACATCTT C_elegans300042 ---AAGCAGTGATGATTT---TATAGTTCAGCTTAT-----CTTCGGATTTGATGAGAAA E_caballus300091 CCGATACAATGATGATAA---CATAGTTCAGCAGAC-----TC---ACGGTGATGAGCAA H_sapiens300199 --GATACAATGATGATAA---CATAGTTCAGCAGAC-----T---AACGCTGATGAGCAA M_musculus300640 CCGATACCATGATGATAA---CATAGTTCAGCAGAC-----TT--AACTCTGATGAACAA * **** ******** * * A_thaliana300188 TAGCACAGTCTTTCGCTCCTATCTGATG------ A_thaliana300189 CAGCATAGTCTTTCGCTCCTATCTGATG------ C_elegans300042 T----------TTCGCCCCTATCAGAGCTTT--- E_caballus300091 TATTA-AGTCTTTCGCTCCTATCTGATGTATCTG H_sapiens300199 TATTA-AGTCTTTCGCTCCTATCTGATGTATC-- M_musculus300640 TCAT---GTCTTTCGCTCCTATCTGATGTATCTG ***** ****** **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved