snOPY snoRNA Orthological Gene Database

Family: SNORD78

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300180 ---TTGAAATG-ATGTTGATCAAATGTCTGACCTGAAATGACCATGTAGA D_novemcinctus300017 ---TTAAAATG-ATGGTGATCAAATGTCTGGCCTGAAATGAACATGTAGA D_novemcinctus300583 ---ACGAAATG-ATGTTGATCAAACATCTGACCTGAAATGAGCGTGTAGA E_telfairi300158 ---TTACAATG-ATGTTTAACGAATGTCTGACCTGAAGAGAGCATGTAGA E_telfairi300219 ATGTTACAATG-ATGTTTAATGAATGTCTGACCTGAAGAGAGCATGTAGA E_caballus300093 ---TTGTAATG-ATGTTGATCAAATGTCTGACCTGAAATGAGCATGTAGA E_europaeus300097 ---ATGTAATG-ATGTTGACCAAATGTCTGACCTGAAATAAGTATGTAGA E_europaeus300098 ---ATGTAATG-ATGTTGACCAAATGTCTGACCTGAAATAAGTATGTAGA E_europaeus300124 ---TTGTAATG-ATGTTGACCAAATGTCTGACCTGAAATAAGTATGTAGA E_europaeus300548 ---TTGGAATG-ATGTTGATCAAATGTCTGACCTAAAATAAATATGTAGA F_catus300120 ---TTGAAATG-ATGTTGACCAAATGTCTGACCTGAAGTGAGCATGTAGA F_catus300163 ---TTGAAATG-ATGTTGACCAAATGTCTGACTGAAAGTGAGCATGTAGA G_gorilla300596 ---CTGTAACG-ATGTTGCTCAAATATCTGACCTGAAATGATTATATAGG G_gorilla300444 ---GTGTAATG-ATGTTGATCAAATGTCTGACCTGAAATGAGCATGTAGA G_gorilla300595 ---ATGTAATA-ATGTTCATCAAATGTCTGACCCGAAATGAGTATGTAGA H_sapiens300201 ---GTGTAATG-ATGTTGATCAAATGTCTGACCTGAAATGAGCATGTAGA M_mulatta300002 ---ACGTAATA-ATGTTCATCAAATGTCTGACCTGAAATGAGCATGTAGA M_mulatta300037 ---CTGTAATG-ATATCGGTCAAATATCTGACCTGAAATGATTATATAGA M_mulatta300186 ---GTGTAATG-ATGTTGATCAAATGTCTGACCTGAAATGAGCGTGTAGA M_murinus300020 ---TTGTAATG-ATGTTGATCAAATGTCTGACCTGAAATGAGCATGTAGA M_murinus300290 ---CTGCAATG-ATGTTGATCAAATGTCTTACCTAAAATGAGCATGTAGA M_domestica300031 ---TTATAATG-ATGTCCT-CAAATGTCTGACCTGAAATCAGCATGTAGA M_musculus300638 ---TTGTAATG-ATGTTGATCAAATGTCTGAGCTGAAAATAACTTGTAGA M_lucifugus300008 ---TTGTAATG-ATGTTGATCAAATGTCTGACCTGAAATTAGCATGTAGA O_anatinus304436 ---TTGTAAGACATTTTCAAGAGAAATCTGACCTGAAATCAGCATGTGTG O_anatinus304424 ---TTACAATG-ATGTCTT-CAAATGTCTGACCTGAA-AGTCTATGTAGA O_cuniculus300001 ---ATGCAATG-ATGTTGATCAAATACCTGACCTGAAGTGAGCATGTAGA O_cuniculus300266 ---TTGTAATG-ATGTTGATCAAATGTCTGATCTGAAAAGAGCATGTAGA O_cuniculus300303 ---TTATAATG-ATGTTGATCAAATGTCTGATCTGAAGTGAGCACGTGGA O_garnettii300000 ---TTGTAATG-ATGTTGATCAAATGTCTGACCTGAAATGAGCATGTAGA O_garnettii300047 ---CTGTAATG-ATCTTGATCAAATGTCTGACCTAAAATGAGCACGTGGA O_garnettii300192 ---TTGTAATG-ATGTTGATCAAATGTCTGACCTGAAATGAGCATGTAGA P_troglodytes300012 ---ATGTAATA-ACGTTCATCAAATGTCTGACCTGAAATGAGCATGTAGA P_troglodytes300176 ---GTGTAATG-ATGTTGATCAAATGTCTGACCTGAAATGAGCATGTAGA P_troglodytes300269 ---CTGTAATG-ATGTTGCTCAAATATCTGACCTGAAATGATTATATAGA P_pygmaeus300562 ---ATGTAATA-ATGTTCATCAAATGTCTGACCTGAAATGAGCATGTAGA P_pygmaeus300573 ---GTGTAATG-ATGTTGATCAAATGTCTGACCTGAAATGAGCATGTAGA P_pygmaeus300178 ---CTGTAACG-ATGTTG-TCAAATATCTGACCTGAAATGATTATATAGA R_norvegicus300168 ---TTGTAATG-ATGTTGATCAAATGTCTGAGCTGAAAATAACTTGTAGA R_norvegicus300315 ---ATGCGATG-ATGTTGATCAAATGTCTGAGCTGAAAGTAACTTGTAGA S_tridecemlineatus300127 ---CTGTAATG-ATGCTGATCAGA----TGAACTGAAATGAGCCTGTAGA S_tridecemlineatus300096 ---TTGTAATG-ATGTTGTTCAAATGTCTGACCTGAAATGAGCATGTAGA T_belangeri300144 ---TTGTAATG-ATGTTGATCAAATGTCTGACCTGAAGTAAGCATGTAGA * * * * ** * C_familiaris300180 CAAATT----TAACACTGAAGAA D_novemcinctus300017 AAAATT----TAATACTGAAGAA D_novemcinctus300583 CA-GATT---TAATGCTTAAGAA E_telfairi300158 CAAATT----TAACACTGAAAAG E_telfairi300219 CAAATT----TAACACTGAAAAG E_caballus300093 CAAATT----TAACACTGAAGAA E_europaeus300097 CAAGTT-----AACACTGAAGAA E_europaeus300098 CAAGTT-----AACACTGAAGAA E_europaeus300124 CAAGTT-----AACACTGAAGAA E_europaeus300548 CAAGTT-----AACACTGAAGGA F_catus300120 CAAATT----TAACACTGAAGAA F_catus300163 CAAATT----TAACACTGAAGAA G_gorilla300596 CC-AATT---TAATACTGAAGAA G_gorilla300444 CA-AAGG---TAACACTGAAGAA G_gorilla300595 CAAGTTAATTTAACACTGAAGAA H_sapiens300201 CA-AAGG---TAACACTGAAGAA M_mulatta300002 CA-AAGT---TAACATTGAAGAA M_mulatta300037 CA-AATT---TAATACTGAAGAA M_mulatta300186 CAGAAGG---TAACACTGAAGAA M_murinus300020 CATATT----TAACACTGAAGAA M_murinus300290 CA-AATT---TAATACTGAAGGA M_domestica300031 TAAATCA---CAGCACTGAAGTG M_musculus300638 CAATTTT---TAACACTGAAGAA M_lucifugus300008 CAACTCT----AACACTGAAGAA O_anatinus304436 CAACTTAA---TACCCTGAAATT O_anatinus304424 CAAGCT----TGCTTCTGAAAGA O_cuniculus300001 AAAATT----TG-CACTGAAGAA O_cuniculus300266 CAAATG-----TGTACTGAAGAA O_cuniculus300303 CAAATT-----TGTACTGAAGAA O_garnettii300000 CGTATT----TAATACTGAAGAA O_garnettii300047 CA-AATG---TAATGCTAAAGAA O_garnettii300192 CATATT----TAATACTGAAGAA P_troglodytes300012 CAAGTTAATTTAACACTGAAGAA P_troglodytes300176 CA-AAGG---TAACACTGAAGAA P_troglodytes300269 CC-AATT---TAATACTGAAGAA P_pygmaeus300562 CA-AAGT---TAACATTGAAGAA P_pygmaeus300573 CA-AAGG---TAACACTGAAGAA P_pygmaeus300178 CC-AATT---TAATACTGAAGAA R_norvegicus300168 CAATTTT---TAACACTGAAGAA R_norvegicus300315 CAACTTT---TAACACTAAGGAA S_tridecemlineatus300127 CA-AATT---TAACATTGAAGAA S_tridecemlineatus300096 CAAGTTT----TATGCTGAAGAA T_belangeri300144 CAAACA----TAGCACTGAAAAG * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved