snOPY snoRNA Orthological Gene Database

Family: SNORD75

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300176 -AGCCTGTGATGGTT---------T-AAGAGTAGTGGACAGAAGGGATTT C_porcellus300562 -AGCCTGTGATGCTTAA-------TACAGAGTAGTGGACAGAAGGGATTT D_rerio300090 -TGCCTATGATGAAT-AAAAATGTATAAGAGTAGTGGACAGGAGTGATTT D_rerio300091 -TGCCTTTGATGAATTAAAAATGTATAAGAGTAGTGGACAGAAGTGATTT D_novemcinctus300021 -AGCCTATGATGGTG---------T-AAGAGTAGTGGACAGAAAGGATTT E_telfairi300162 -AGCCTGTGATGGTA---------TTCAGAGTAGTGGACTGAAGGGATTT E_caballus300097 -AGCCTGTGATGGTT---------T-AAGAGTAGTGGACAGAAAGGATTT E_europaeus300073 -AGCCCATGATGGT----------TTAAGAGTAGTGGGCAGAAGGGATTT E_europaeus300143 -AGCCCATGATGGT----------TTAAGAGTAGTGGGCAGAAGGGATTT E_europaeus300500 -AGCCTATGGTGGT----------TTAAGAGTAGTGGACAGAAAAGATTT G_aculeatus300079 -AGTCTGTGATGCAT----------TTAGAGTAGTGGACAGATGTGATTT G_gorilla300448 -AGCCTGTGATGCTT---------T-AAGAGTAGTGGACAGAAGGGATTT H_sapiens300205 -AGCCTGTGATGCTT---------T-AAGAGTAGTGGACAGAAGGGATTT L_africana300387 -AGCCTGTGATGGT----------GTAAGAGTAGTGGACAGAAGAAATTT M_mulatta300272 -----AGTGATGGTT---------T-AAAAGTAATGGACAGAAGG--TTT M_mulatta300401 ATTTCTATGGAAAAG-----------AGGTGAAGTGGACAGAAGGGATGT M_murinus300024 -AGCCTGTGATGGTT---------TTAAGAGTAGTGGACAGAAGGGATTT M_murinus300130 -AGCCTGTTATGGTT---------T-AACAGTAGTG-ACAGAAGGAACTT M_domestica300034 -AGCCTATGATGTCC----------TAAGAGTAGTGGACAGAAATGATTT M_musculus300796 -AGCCCATGATGGT----------ATGAGAGTAGTGGACAGAAGGGATTT M_lucifugus300012 -AGCCTGTGATGGTT---------T-AAGAGTAGTGGACAGAAGGAGTTT O_anatinus304423 -AGCCAGTGATGACT-TTAAATG-ATAAGAGTAGTGGACAGAAGAGATTT O_anatinus304429 -AGCCTATGATGGTT---TTAAGTATAAGAGTAGTGGACAGATGTGATTT O_cuniculus300243 -AGCCTGTGATGGT----------TTAAGAGTAGTGGACAGAAGGGATTT O_latipes300025 -AGTCAGTGATGATT----AATGTGTAAGAGTAGTGGACAGGAGTGATTT O_garnettii300004 -AGCCTGTGATGGTT---------TTAAGAGTAGTGGACAGAAGGGATTT O_garnettii300200 -ATTCTGT-ATAGCA---------CTAGGAGCGGGGGACAGAAGGAATTT P_troglodytes300138 -GGCCAGTGATGGTT---------T-AAAAGTAATGGACAGAAGG--TTT P_troglodytes300180 -AGCCTGTGATGCTT---------T-AAGAGTAGTGGACAGAAGGGATTT P_troglodytes300212 ATTTCTATGGAAAAG-----------AGGTGAAGTGGACAGAAGGGATGT P_pygmaeus300057 -GGCCAGTGATGGTT---------T-AAAAGTAATGGACAGAAGG--TTT P_pygmaeus300429 ATTTCTACGGAAAAG-----------AGGTGAAGTGGACAGAAGGGATGT P_pygmaeus300569 -AGCCTGTGATGCTT---------T-AAGAGTAGTGGACAGAAGGGATTT R_norvegicus300165 -AGCCCATGATGGT----------ATGAGAGTAGTGGACAGAAGGGATTT S_tridecemlineatus300008 -AAGTCATGACAGTG---------T-AAGAGTAGTGGACAGAAGGGATTT T_nigroviridis300012 -AGTCTGTGATGATC----CACATGTGAGAGTAGTGGACAGAAGACATTT T_belangeri300148 -AGCCTGTGATGGT----------TAAAGAGTAGTGGACAGAAGGGATTT X_tropicalis300046 -AGCCAGTGATGCTT---------CAAAGAGTAGTGGACAGGTGTGATTT * * * * * C_familiaris300176 CTGAAAAG--TTTTACTCTGAGGCT------ C_porcellus300562 CTGAAACG--TTTGCTTCTGAGGCT------ D_rerio300090 CTGATAA--TTTTTACTCTGAGGCA------ D_rerio300091 CTGAGAACATTTTTAATCTGAGGCA------ D_novemcinctus300021 CTGAGAAA--TTATATGCTGAGGCT------ E_telfairi300162 CTGAAAGA--AAAAAAAGTAATGCTGAGGCT E_caballus300097 CTGAAAAG--CTGTATTCTGAGGCT------ E_europaeus300073 CTGAAAAA--AAAAAAATTAACT-------- E_europaeus300143 CTGAAA-----AAAATCTTAGCTGAGGCT-- E_europaeus300500 CTGAAAAA--AAAAATCCAAACT-------- G_aculeatus300079 CTGACAAA--TTCAACTCTGAGACT------ G_gorilla300448 CTGA--AA--TTCTATTCTGAGGCT------ H_sapiens300205 CTGA--AA--TTCTATTCTGAGGCT------ L_africana300387 CTGAAAAA--TTCTGTGCTGAGGCT------ M_mulatta300272 CTGA-AAT--TCT-ATTTTGAAGCT------ M_mulatta300401 CTGAAA----TTCTATCCTGAGGCT------ M_murinus300024 CTGA--AA--TTCTATTCTGAGGCT------ M_murinus300130 CTGA--AA--TTCTATTCTAAGGCT------ M_domestica300034 CTGACAA---TAATATACTGAGGCT------ M_musculus300796 CTGAAAAA--CACTTTTCTGAGGCT------ M_lucifugus300012 CTGACAAA--TCCTATTCTGAGGCT------ O_anatinus304423 CTGAATAC-TTGAAACGCTGAGGCT------ O_anatinus304429 CTGACAAC---TGACTACTGAGGCT------ O_cuniculus300243 CTGAAA-A--TGACGTTCTGAGGCT------ O_latipes300025 CTGACAAACTATATACACTGATGCT------ O_garnettii300004 CTGA--AA--TTCTATTCTGAGGCT------ O_garnettii300200 CTGAAATC--CATCTCCCAAAGAAT------ P_troglodytes300138 CTGA-AAT--TCT-ATTTTGAAGCT------ P_troglodytes300180 CTGA--AA--TAATATTCTGAGGCT------ P_troglodytes300212 CTGAAA----TTCTATCCTGAGGCT------ P_pygmaeus300057 CTGA-AAT--TCT-ATATTGAAGTT------ P_pygmaeus300429 CTGAAA----TTCTATCCTGAGGCT------ P_pygmaeus300569 CTGA--AA--TTCTATTCTGAGGCT------ R_norvegicus300165 CTGAAAAA--CACTGTTCTGAGGCT------ S_tridecemlineatus300008 CTAA-AAT--TTTTATTTTGAAACTT----- T_nigroviridis300012 CTGAGCAA--TCTAATGCTGAGACT------ T_belangeri300148 CTGAAAAA--TACTGGGCTGAGGCT------ X_tropicalis300046 CTGACAGC-TTGTAAAACTGAGGCT------ ** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved