snOPY snoRNA Orthological Gene Database

Family: SNORD74

CLUSTAL W (1.83) multiple sequence alignment C_elegans300003 --------CTGTGTATGACGACAA----CGT--G----TTAGGGACATCT C_elegans300021 ----------GTGTATGACGACAA----CAT--G----TTAGGGACATCT C_familiaris300175 ---GCTTCCTGCCTGTGATGAAGC-CTGTGTTGG-----TAGGGACATCT C_porcellus300563 --GTGCCTTGCTC-ATGATGAAGC-CTGTGTTGG-----TAGGGACATCT D_rerio300092 ---TGTTTACTTGTATGATGAAGA-ATATGTTGG-----TAGGGACATCT D_novemcinctus300022 ---GTGCCCTGCCTCTGATGAAAC-CAATGTTGG-----TAGGGACATCT D_novemcinctus300337 ---ATGCCCTGCCTCTAATGAAGC-CAATGTTGG-----TAGGGACATCT D_melanogaster300073 --------ACAACCATGATGAAAT----CGTTAG----ATGGGGACAACT D_melanogaster300074 --------TTTTTTGTGATGAAAT----CGTTAG----ATAGGGACGTCT D_melanogaster300075 --------TTTTTTGTGATGAAAT----CGTTAG----ATAGGGACGTCT E_telfairi300163 ---GTGGCGTGCCTGTGATGAAGC-TCGTGTTGG-----TAGGGACATCT E_caballus300098 ---GTGTCCTGCCTCTGATGAAGC-CTGTGTTGG-----TAGGGACATCT E_europaeus300142 ---GGCCTCCGCCTCTGATGAAGT-CATTGTTGG-----TAGGGACAGCT E_europaeus300530 ---AAAATACGCCTCTGATTAAGT-CATTATTGG-----TAGGGACAGCT H_sapiens300206 --------CTGCCTCTGATGAAGC-CTGTGTTGG-----TAGGGACATCT L_africana300388 ---GTGCCCTTCCTGTGATGAAAC-CTGTGTTGG-----TAGGGACATCT M_mulatta300033 -TAGACAAAGGCTTCTTATGAAGC-CTATGTTGG-----TAGAGACATCT M_mulatta300044 ---ATGTGATGCCTCTGATGAAGC-CTATGTTA-----GTAGAGACATCT M_mulatta300190 ---GTGCCCTGCCTGTGATGAAGC-CTGTGTTGG-----TAGGGACATCT M_mulatta300194 --------CAGCCTCTGATGAAGC-CTATGTTATA---GTAGGAACATCT M_mulatta300379 ---GAAAACAGTTTCTGATGAAGC-CTATGTTGG-----TAGAGACAACT M_mulatta300518 ---------------------------CTTCCCA-----AAGATGAATGA M_mulatta300627 --------CAGCCTTTGAGGAAGC-CTGTGTTG-----GTAGCAACATCT M_mulatta300690 ---ACAAACAGGCTCTGATGAAAC-CTATCTTGA-----TAGGGACATCT M_mulatta300740 ---TTGATCCACCTCTGATGAAAC-CTGTGTTG-----GTGGGGACATCT M_murinus300025 ---GTTCCCTGCCTCTGATGAAGC-CTGTGTTGG-----TAGGGACATCT M_murinus300117 ---TCTATGAGCTTCTGATGAAGC-CTACATTT-----GTAGGGACATAT M_murinus300247 ---GTAGGCAGCCTTTGATGAAGC-CTGTGTTGG-----TAAGGACACCT M_murinus300275 ----------GCCTCTGATGAAAC-CTATGTTG-----GTAGTGACATCT M_murinus300390 --------CAGCCTCTAATGACGC-CTCCACTGG-----TAGAAACATCT M_murinus300553 TTGAGGAGCAGTCTTTGAGGAAGC-CGGAGTGG-----GTAGGGACATCT M_domestica300035 ---CCTTGCTGTGTGTGATGAAAG-TAACGTTGG-----TAGGGACATCT M_musculus300795 --GTG-TTCATGCTATGATGAAGG-CTATGTTGG-----TAGGGACAACT O_anatinus303448 ---TGCCCTTACCTGTGATGAAAACAAGTGTTGG-----TAGGGACATCT O_anatinus304430 ---TGCCCCTACCTGTGATGAAAACAAGTGTTGG-----TAGGGACATCT O_garnettii300005 ---GTGCCCTGCCTCTGATGAAGC-CCATGTTGG-----TAGGGACATCT O_garnettii300146 -----------------TTCAAGC-CTTGGTTG-----GTAGAGACATCT O_garnettii300429 -------TTAGCCTCTGATGGAGC-CTATGTTA-----GTAGGGGCATTT O_garnettii300439 ---TCTTGTCACCTCTGACGAAGC-CCATGTTG-----GTAGGGACATCT O_garnettii300609 ---GAAATTGGCTTCTAATGTAGC-CCATTTTAG-----TAGGGACATCT P_troglodytes300083 -----------TTTCTGATGAAGC-CTATGTTGG-----TAGAGACATCT P_troglodytes300098 ---CAGTCCAGCCTCTGATGAAGC-CTATGTTA-----GTAGGCACATCT P_troglodytes300132 ---GAAAACAGTTTCTGATGAAGC-CTATGTTGG-----TAGGGACAACT P_troglodytes300181 ---GTGCCCTGCCTCTGATGAAGC-CTGTGTTGG-----TAGGGACATCT P_troglodytes300499 ---ACAAACAGCCTCTGATGAAAT-TTATCTTGA-----TAGGGACATCT P_troglodytes300564 ---TTGATCTACCTCTGATGAAAC-CTGTGTTG-----GTGGGGACATCT P_troglodytes300652 --------CAGCCTTTGAGGAAGC-CTGTGTTT-----GTAGGGACATCT P_pygmaeus300015 -----------TTTCTGATGAAGC-CTATGTTGG-----TAGAGACATCT P_pygmaeus300122 ---ATGTGATGCCTCTGATGAAGC-CTATGTTA-----GTAGAGACATCT P_pygmaeus300380 ---GGAAACAGTTTCTGATGAAGC-CTATGTTGGGTTGGTAGGGACAACT P_pygmaeus300449 ---ACAAACAGCCTCTGATGAAAC-TTATCTTGA-----TAGGGACATCT P_pygmaeus300568 ---GTGCCCTGCCTCTGATGAAGC-CTGTGTTGG-----TAGGGACATCT P_pygmaeus300652 --------CAGCCTTTGAGGAAGC-CTGTGTTT-----GTAGGGACATCT P_pygmaeus300670 ---TTGATCTACCTCTGATGAAAC-CTGTGTTG-----GTGGGGACATCT R_norvegicus300164 --GTGACTCTTGCAATGATGAAGG-TTATGTTGG-----TAGGGACAACT S_cerevisiae300000 ----------TTGTATGATGAGGA-----ACCAG----ATAGGGACAACA S_tridecemlineatus300228 --------ATGCCTGGGATGAAGC-CTGTGTTGG-----TAGGGACATCT T_nigroviridis300013 ---CCCATGAATACATGATGAAAA-AAGTGTTGG-----TAGGGACATCT T_belangeri300048 ---AAGAAGAACCTCTGATGAAGC-CTGTGGTGG-----TAGGGACATCT T_belangeri300149 ---TTCCCCTGCCTCTGATGAAGC-CTGTGTTGG-----TAGGGACATCT X_tropicalis300043 ----ATGCCTGAGAATGATGAAAA-TTATGTTGG-----TAGGGACATCT C_elegans300003 GCACCAACC------GTGAA-GATTTAA--CGAAAGTAGTACTGACACAG C_elegans300021 GCACAAACC------GTGAA-GATTTAA--CGAAAGTAGTACTGACACAG C_familiaris300175 GAGACT------------GTTG-ATGA--ATGCCAACGGCTCTGATGGCG C_porcellus300563 GAG--T------------GCTG-ATGA--ATGCCAACGGCTCTGATGGCG D_rerio300092 GAGAAA-----------ATCTG-ATGAA--TGCCAACATTTCTGACATGT D_novemcinctus300022 GACGAT------------GTTG-ATGA--ATGCCAACAGCTCTGATGGTG D_novemcinctus300337 GACGAC------------AATG-ATGA--ATGCCAGTAGCTCTGATGGTG D_melanogaster300073 GA--TTACT------GTGACTGATTCATCTCGATAGTAGATCTGATTTT- D_melanogaster300074 GA--TATCT------GTGACTGATTTATCTCGATAGTAGATCTGATTTT- D_melanogaster300075 GA--TATCT------GTGACTGATTTATCTCGATAGTAGATCTGATTTT- E_telfairi300163 GAGACT--------------TG-ATGA--ATGCCAACTGCTCTGATGGC- E_caballus300098 GAGACT------------GTTG-ATGA--ATGCCAACGGTTCTGATGGCG E_europaeus300142 GAGACG-------------CTG-ATGA--ACGCCAACGGCTCTGATGGCG E_europaeus300530 GAGAGA------------GAAA-ATAAAAGCACATAGAGAGCAGTTA--- H_sapiens300206 GAGAGT------------AATG-ATGA--ATGCCAACCGCTCTGATGGTG L_africana300388 GAGACT--------------TG-ATGA--ATGCCAACTTCTCTGATGGCA M_mulatta300033 GAGAGT------------ATTG-ACTA--ATGCCAACAGCTTAAATGGGG M_mulatta300044 GAGAGT------------GTAG-ATGA--ATGCCAATGGCCCTCATGGAA M_mulatta300190 GAGAGT------------AATG-ATGA--ATGCCAACCGCTCTGATGGTG M_mulatta300194 GA--GT------------GGTA-ATGA--ATGCCAGCAGCTCTCATGAAA M_mulatta300379 AAGGTT------------GTTG-ATGA--ATGCTGACAGCTCTATCACAC M_mulatta300518 AGGAGT------------AATG-ATGA--ATGCCAACCGCTCTGATGGTG M_mulatta300627 GAGAGT------------GTTG-ATGA--ATGCCAACGGCTCTGATGGAA M_mulatta300690 GAAAGT------------GTTG-ATGA--ATGCCATGGACTCTAATGGA- M_mulatta300740 GAGAGT------------GTTG-ATGA--ATGCCAGTGACTCTGATAGAA M_murinus300025 GAGAAT------------GTTG-ATGA--ATGCCAACTGCTCTGATGGCC M_murinus300117 GAGAGT------------GCTG-ATGA--ATGCCAACCCCTGTGATGGGA M_murinus300247 GAGGGT------------GAAGTGTGGCAGAGTTAAAGGAACCAAC---- M_murinus300275 GACAGT------------GTTA-ATGAGAATGCCAACTGCTCTGATGAAA M_murinus300390 GAGAAT------------GTTG-ATGA--ATGCCAACAGGTTTGATGGGA M_murinus300553 GAGAGT------------GTTG-ATGA--ATGCCAGCAGCTCTGATGGAA M_domestica300035 GAGATT------------GCTG-ATGA--ATGCCAACGTCTCTGATGCGG M_musculus300795 GAGCTT------------GTTG-ATGA--ATACCAACGATTCTGATGGCA O_anatinus303448 GAGA-A-----------AGCTG-ATGAA--TGCCAACACAGCTGAGTCGG O_anatinus304430 GAGA-A-----------AGCTG-ATGAA--TGCCAACACAGCTGAGTCGG O_garnettii300005 GAGAGT--------------TG-ATGA--ATGCCAACTGCTCTGATGGTG O_garnettii300146 GAGAGT------------GCTG-GAGA--GTGCCAACGAGTCT-ATGGAA O_garnettii300429 GAGAGT------------GTTG-ATGA--ATGCCCACCCCTCTGATGAAA O_garnettii300439 GAGAGTCCAACTCTCAGAGTTGGATGA--ATGCCAACTGCTCTGATGGAA O_garnettii300609 GAGAGT-------------AAGGGTG--AATGTCAATGGAGCTGACAAAA P_troglodytes300083 GAGAGT------------ATTG-ATGA--ATGCCAACAGCTTCAATGGAG P_troglodytes300098 GA--GT------------GGTA-ATGA--ATGCCAGCAGCTCTGATGAAA P_troglodytes300132 AAGGTT------------GTTG-ATGA--ATGCTAACAGCTCTAACACAC P_troglodytes300181 GAGAGT------------AATG-ATGA--ATGCCAACCGCTCTGATGGTG P_troglodytes300499 GAAAGT------------GTTG-ATGA--ATGCCAAGGACTCTGATGGA- P_troglodytes300564 GAGAGT------------GTTG-ATGA--ATGCCAGTGACTCTGATAGAA P_troglodytes300652 GAGAGG------------GTTG-ATGA--ATGCCAACGGCTCTGATGGAA P_pygmaeus300015 GAGAGC------------ATTG-ATGA--ATGCCAACAGCTTAAATGGGG P_pygmaeus300122 GAGAGT------------GTAG-ATGA--ATGCCAATGGCCCTCATGGAA P_pygmaeus300380 AAGGTT------------GTTG-ATGA--ATGCTAACAGCTCTAACACAC P_pygmaeus300449 GAAAGT------------GTTG-ATGA--ATGCCAAGGACTCTAATGGA- P_pygmaeus300568 GAGAGT------------GATG-ATGA--ATGCCAACCGCTCTGATGGTG P_pygmaeus300652 GAGAGT------------GTTG-ATGA--ATGCCAACGGCTCTGATGGGA P_pygmaeus300670 GAGAGT------------GTTG-ATGA--ATGCCAGTGACTCTGATAGAA R_norvegicus300164 GACCTT------------GTTG-ATGA--ATACCAACAATTCTGATGGCA S_cerevisiae300000 GATTCTCAA------GTGAC-GAGGAACATCTTTTAAAGCCCAGTTTTTA S_tridecemlineatus300228 GAAAGT------------GCTG-ATGA--ATGCCAGTGGCTCTGATGGTG T_nigroviridis300013 GAGATA-----------AGGTG-AAGAA-ATGCCAACTCTTCTGATTTCA T_belangeri300048 GAGAAA------------ACTG-ATGA--ATGCCAATGGCTCTGATGGCA T_belangeri300149 GAGAAA------------ACTG-ATGA--ATGCCAACGGCTCTGATGGCA X_tropicalis300043 GAGAGC------------AGTG-ATGA--TTACCAACGTCTCTGATCAGG C_elegans300003 --------------------------- C_elegans300021 --------------------------- C_familiaris300175 GCGC----------------------- C_porcellus300563 GCGC----------------------- D_rerio300092 AGCA----------------------- D_novemcinctus300022 GCGC----------------------- D_novemcinctus300337 GCGC----------------------- D_melanogaster300073 --------------------------- D_melanogaster300074 --------------------------- D_melanogaster300075 --------------------------- E_telfairi300163 GCAT----------------------- E_caballus300098 GTGC----------------------- E_europaeus300142 GAAC----------------------- E_europaeus300530 --------------------------- H_sapiens300206 G-------------------------- L_africana300388 GTGC----------------------- M_mulatta300033 AAAA----------------------- M_mulatta300044 AGAG----------------------- M_mulatta300190 GCAC----------------------- M_mulatta300194 AAAA----------------------- M_mulatta300379 --------------------------- M_mulatta300518 GAAG----------------------- M_mulatta300627 AAAA----------------------- M_mulatta300690 --------------------------- M_mulatta300740 AAAA----------------------- M_murinus300025 GAAC----------------------- M_murinus300117 AAAA----------------------- M_murinus300247 --------------------------- M_murinus300275 AAAA----------------------- M_murinus300390 GAAA----------------------- M_murinus300553 ACAA----------------------- M_domestica300035 GG------------------------- M_musculus300795 GAGC----------------------- O_anatinus303448 GGCT----------------------- O_anatinus304430 GGCT----------------------- O_garnettii300005 GAGC----------------------- O_garnettii300146 ATAA----------------------- O_garnettii300429 AAAA----------------------- O_garnettii300439 AATA----------------------- O_garnettii300609 AAAT----------------------- P_troglodytes300083 AAAA----------------------- P_troglodytes300098 AAAA----------------------- P_troglodytes300132 --------------------------- P_troglodytes300181 GCAC----------------------- P_troglodytes300499 --------------------------- P_troglodytes300564 AAAA----------------------- P_troglodytes300652 AAAA----------------------- P_pygmaeus300015 AAAA----------------------- P_pygmaeus300122 AGAG----------------------- P_pygmaeus300380 ACAC----------------------- P_pygmaeus300449 --------------------------- P_pygmaeus300568 GCAC----------------------- P_pygmaeus300652 AAAA----------------------- P_pygmaeus300670 AAAA----------------------- R_norvegicus300164 GAGC----------------------- S_cerevisiae300000 GTAGAGCTTAGGGCGCCTTTACTGACT S_tridecemlineatus300228 GTGT----------------------- T_nigroviridis300013 TGGG----------------------- T_belangeri300048 GTAT----------------------- T_belangeri300149 G-------------------------- X_tropicalis300043 CCAT-----------------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved