snOPY snoRNA Orthological Gene Database

Family: SNORD73

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300439 AATGAGTGATGACAAAATGTTTCGGTCCCAAATGATA------CATATTG C_familiaris300440 AATAGATGATGACAAAATGTTTCGGTCCCAGATGACAACC------ACTG C_porcellus300365 TATAAGTGATGAAAAAATGTTTTGGTCCCAGTTGATGTCC------ACTG C_porcellus300837 AATGAATGATGACAAAATGTTTCGGTCCCAGATGACAC------AAACTG D_novemcinctus300560 AATACATGATGAGAAAATGTTTCGGTCCCAGCTGATGTAC------ACTG E_telfairi300031 AATGAAGGATGACAAAATGTTTCGGTCCCAAATGAT-C------GTACTG E_telfairi300719 AATAAGTGATGAAAACCTGTTTCGGTCCCAGCTGATGTCC------TGTG E_caballus300293 AATAGATGATGACAATGTGTTTCGGTCCCATATGATGTCC------GGTG E_caballus300294 AATGAATGATGACAAGATGTTTCGGTCCCAGATGATAC------ATACTG E_europaeus300559 GATAAATGATGACAACATGTTTCGGTCCCAAATGATGTCC------AGTG E_europaeus300560 AATGAATGATGACAAAATGTTTCGGTCCCATATGAT--TGA----CACTG F_catus300195 AATGAATGATGACAAAATGTTTTGGTCCCAAATGATACTGA--TATACTG G_gallus300084 AATGAATGATGACAAATTGTTTCGGTCCCAGATGACACGA------AATG H_sapiens300542 AATGAATGATGACAAAATGTTTCAGTCCCAAATGATAC------ATACTG H_sapiens300543 AATAAGTGATGAAAAAA-GTTTCGGTCCCAGATGATGGCC------AGTG L_africana300190 AATGAGTGATGACAAAATGTTTCGGTCCCAAATGATA------AATACTG L_africana300191 AATAAATGATGAAAAACTGTTTCGGTCCCAGCTGATGTCC------TGTG L_africana300449 AATAAATGATGAAAAACTGTTTCGGTCCCAGCTGATGTCC------TGTG M_mulatta300017 AATGAATGATGACAAAATGTTTCGGTCCCAAATGATAC------ATACTG M_mulatta300060 AATAAGTGATGAAAAAA-GTTTCGGTCCCAGATGATGGCC------AGTG M_mulatta300467 AATAAGTGATGAAAAAA-GTTTCGGTCCCAGATGATGGCC------AGTG M_murinus300561 AATGAATGATGACAAAATGTTTCGGTCCCAAATGATAC------ATACTG M_murinus300562 CATAAATGATGAAAAAATGTTTCGGTCCCAGATGATATCC------AATG M_domestica300170 AATAAATGATGA-AAAATGTTTCGGTCCCAATTGATATCT------AATG M_domestica300171 AATGAATGATGACAAAATGTTTCGGTCCCAAATGATAC------ATAATG M_musculus300903 AACATGTGATGAGAAACTGTTTCGGTCCCAGTTGATGGCC------ACTG M_musculus300904 AATGAGTGATGACAAGATGTTTCGGTCCCAAATGAAG------CCTACTG O_anatinus302235 AACGGGTGATGACCACATGTTTCGGTCCCAGATGAC-GCC--------GT O_anatinus302236 GATACGTGATGACAAGATGTTTCGGTCCCAGATGACGTCC------CGTG O_anatinus303085 GATGTGTGATGACAAAATGTTTCGGTCCCAAATGACATTC------CATG O_cuniculus300505 AATGAATGATGACAAAATGTTTCGGTCCCAAATGATATTGATATACACTG O_cuniculus300506 AATAAGTGATGAAAAAA-GTTTCGGTCCCAGATGATGTCC------GATG O_latipes300088 AACGTGTGATGACATTTTGTTTCGGTCCCAGATGACTGCC--------TG O_garnettii300610 CATAAGTGATGAAAAAA-GTTTCGGTCCCAGATGATGTCC------GATG P_troglodytes300566 AATGAATGATGACAAAATGTTTCAGTCCCAAATGATAC------ATACTG P_troglodytes300567 AATAAGTGATGAAAAAA-GTTTCGGTCCCAGATGATGGCC------AGTG P_pygmaeus300110 AATGAATGATGACAAAATGTTTTGGTCCCAAATGATAC------ATACTG P_pygmaeus300111 AATAAGTGATGAAAAAA-GTTTCGGTCCCAGATGATGGCCC-----AGTG R_norvegicus300968 AATGTGTGATGAGAAAATGTTTCGGTCCCAGTTGATGACC------ACTG R_norvegicus300969 AATGAGTGATGACAGGATGTTTCGGTCCCATATGAAT------CCTACTG S_araneus300949 AATATGTGATGACAAA-TGTTTCGGTCCCAGATGATGTCC------AGTG S_tridecemlineatus300123 AATGAATGATGACAAAATGTTTCGGTCCCAAATGATAC------ATCTTG T_belangeri300170 AATGAATGATGACAAAATGTTTCGGTCCCAGATGATAC------ATCCTG T_belangeri300329 AATATGTGATGAAAAAATGTTTCGGTCCCAGCTGATGTAC------AGTG X_tropicalis300074 AATGAATGATGACAATATGTTTCGGTCCCAAATGATCATC------TGTG X_tropicalis300075 AATGAATGATGACAAAATGTTTCGGTCCCAAATGATT-TC------TATG * ***** **** ****** *** C_familiaris300439 ATTATACCG-CTA--------CATTTACTTC-TGACATT C_familiaris300440 ATAAAACT------------TAACATTTTTC-TGATGTT C_porcellus300365 ATAAC-TG------------TTACATTTTTC-TGATGTT C_porcellus300837 ATTATACCGTTAC---------ATTTATTTC-TGACATT D_novemcinctus300560 ATAA--CT------------TAACATTTTTC-TGATGTT E_telfairi300031 ATTATACCGTTAT---------GTTTGGTTC-TGACATT E_telfairi300719 ATAA---T------------GCACATTTT-C-TGATGTT E_caballus300293 ATAAAACTG----------TTAACATTTTTC-TGATGTT E_caballus300294 ATTATACCGTTAC---------ATTTATTTC-TGACATT E_europaeus300559 ATATAACT--------------ACATTTTTC-TGATGTT E_europaeus300560 ATTATACCG-TTA--------CATTAATTTC-TGACATT F_catus300195 ATTATACTGTTAG---------GTTTATTTC-TGACATT G_gallus300084 ATTTTAATT-----------TTCCCATTTTC-TGACATT H_sapiens300542 ATTATACCATTA---------TATTTATC-C-TGACATT H_sapiens300543 ATAA--CA--------------ACATTTTTC-TGATGTT L_africana300190 ATTAGACCG-TTA--------CATTTATTTC-TGACATT L_africana300191 ATAA---C------------TTGCATTTTTC-TGATGTT L_africana300449 ATAA---C------------TTGCATTTTTC-TGATGTT M_mulatta300017 ATTATACCGTT-------------TTATC-C-TGACATT M_mulatta300060 ATAA--CT------------T-ACATTTTTC-TGATGTT M_mulatta300467 ATAA--CT------------T-ACATTTTTC-TGATGTT M_murinus300561 ATTATACCGTTAC---------ATTTATTTC-TGACATT M_murinus300562 ATAACTGT-------------TACATTTTTC-TGATATT M_domestica300170 ATAAT-----------------ACATTGTTC-TGATATT M_domestica300171 ATTATACCATTGC---------ATTT-TTTC-TGACATT M_musculus300903 ATAA--CA------------TTACATTTTTC-TGATGTT M_musculus300904 ATT--ACCG-TAA--------CATTTATTGC-TGACATT O_anatinus302235 GTGATTTCACCGT--------TGCGATTTTC-TGACGTT O_anatinus302236 ATTTGACTG-----------TTGCATTTTTC-TGACGTC O_anatinus303085 ATTTGACTG-----------TTGCATTTTTCCTGACATC O_cuniculus300505 ATTATACCG-TTA--------CATTA-TTTC-TGACATT O_cuniculus300506 ATAAAT---------------TACATTTTTC-TGATATT O_latipes300088 ATTACTTTTAAAT--------TGAGATCAAC-TGATGTT O_garnettii300610 ATAACT---------------TACATTTTTC-TGATATT P_troglodytes300566 ATTATACCGTTAATACCGTTATATTTATC-C-TGACATT P_troglodytes300567 ATAA--CA--------------ACATTTTTC-TGATGTT P_pygmaeus300110 ATTATACCATTAC---------ATTTATC-C-TGACATT P_pygmaeus300111 ATAA--CT------------T-ACATTTTTC-TGATGTT R_norvegicus300968 ATAATAAC------------TCACATTTTTC-TGATGTT R_norvegicus300969 ATTTCACCGATAA--------CATTTCTTGC-TGACATT S_araneus300949 ATAAGATT------------TAACATTTTTC-TGATGTT S_tridecemlineatus300123 ATTATACTGTTAC---------ATTTATTTC-TGACATT T_belangeri300170 ATTATACCGTTAC---------GTTTGTTTC-TGACATT T_belangeri300329 ATAA---G------------TTACATTTTTC-TGATGTT X_tropicalis300074 ATTATTGCT----------TTGAGATCGTTC-TGACTTT X_tropicalis300075 ATTACT-CT----------TTGAGATCGTTC-TGACATT * * *** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved