snOPY snoRNA Orthological Gene Database

Family: SNORD72

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300199 AGCTTATCAATGATGTTG-TAAAAATAAATGTCTGAACATATG-AATTTG D_rerio300174 GGCTTACCAGTGATGTTC--AAAAATAAATGTCTGAACAAATG--ACTGT D_rerio300175 AGCTTACCAGTGATGTGC--AAAAATAAATGTCTGAACAAATG--AGTGT E_telfairi300773 AGCTTATCGGTGATGTTG-TAAAAATAAATGTCTGAACATATG-AGTACA E_caballus300016 AGCTTATCTGTGATGTTG-TAAAGATAAATGTCTGAACATATG-AATTCG F_catus300246 AGCTTATCCATGATGTTG-TAAAAATAAATGTCTGAACATATG-AATTTG G_gallus300122 AGCTTGTCAATGATGTTTCTTACTA-AAATGTCTGAACATATG-AACTTC G_aculeatus300131 TGCTTACCAATGATGCTG--AAAAATAAATGTCTGAACAAATG-ATTTCT H_sapiens300547 AGCTTATCAGTGATGTTG-TAAAAATAAATGTCTGAACATATG-AATGCA L_africana300106 AGCTTATCAGTGATGTCA-TAAAAATAAATGTCTGAACATATG-AATACA M_mulatta300722 AGCTTATCAGTGATGTTG-TAAAAATAAATGTCTGAACATATG-AATGCA M_murinus300080 TTCATATCAGTGATATTG-TAAAAATAAATGTCTGAACATG---AATACC M_murinus300189 AGCTTATCAGTGATGTTG-TAAAAATAAATGTCTGAACATATG-AAT--A M_domestica300145 AGCTTGTCAGTGATGTACTTTGAAAAAAATGTCTGAACATATG-AA-TTA M_musculus300852 AGCTTATCAATGATGTCCTAAAAAATAAATGTCTGAACATATG-ACTGCT O_anatinus302260 AGCTTATCGATGATGTACTCGAAAAAAAATGTCTGAACATATG-AGTCCG O_anatinus304528 AGCTTATCGATGATGGTGATTAAAAAAAAATGCCGGAACTATG-CGTTCA O_garnettii300119 CTATTATCAGTGATGTTG-TAAAAATAAATGTCTGAGCATATGAATTACC P_troglodytes300707 AGCTTATCAGTGATGTTG-TAAAAATAAATGTCTGAACATATG-AATGCA P_pygmaeus300759 AGCTTATCAGTGATGTTG-TAAAAATAAATGTCTGAACATATG-AATGCA R_norvegicus300966 AGCTTATCGATGATGTCCTAAAAG-TAAATGTCTGAACATATG-AATGCT S_araneus300440 AGCTTATCGATGATGTTG-CAAAAATAAATGTCTGAACATATG-AATTCA S_tridecemlineatus300274 AGCTTATCGGTGATGTTG-TACAAATAAATGTCTGAACATATG-AATGCA T_nigroviridis300040 GTCTTGTCAGTGATGTTAATCAT---AAATGTCCGAACATATG-A--CTT T_nigroviridis300041 TGCTCACCCATGATGGAC--CTAGAAAAATGTCCGAACAGATG-AATAAA * **** *** * * C_familiaris300199 ATACTGATTTCAGCATTT-AACTGAGATAAGCT- D_rerio300174 CCAGTGATAACAGATTT-GTACTGAGGTAAGCC- D_rerio300175 CCAGTGATAACTGATTTTGAACTGAGGTAAGCC- E_telfairi300773 ATAATGATTTCAGCATCA-AACTGAGATGAGCT- E_caballus300016 ATACTGATTTCAGCATTT-AACTGAGATAAGCT- F_catus300246 ATACTGATTTCAGCATTC-AACTGAGATAAGCT- G_gallus300122 ATAGTGATTTCAGTGCAT-TACTGAGATAAGCT- G_aculeatus300131 AT-ATGATATCAACATTTTCTCTGAGGTAAGCT- H_sapiens300547 GTATTGATTTCAGCATTT-AACTGAGATAAGCG- L_africana300106 ATACTGATTTCAGCATTT-GCCTGAGATAAGCT- M_mulatta300722 GTACTGATTTCAGCATTT-AACTGAGATAAGCG- M_murinus300080 ATATCGATTTCAGTATTT-AACTGAGATTAAGAA M_murinus300189 ACATTGATTTCAGCATTT-AACTGAGATAAGCT- M_domestica300145 ATAGTGATTTCAGCATTT-AACTGAGATGAGCT- M_musculus300852 ATAATGATTTCAGCATTT-AACTGAGATAAGCT- O_anatinus302260 CTAGTGATTTCAACGCGC--ACTGAGATAAGCG- O_anatinus304528 GTAGTGATTTCACCATTT-CTCTGAGATACGCT- O_garnettii300119 ATATTGATTTCAGCAGTA-GACTGAGATTAAAA- P_troglodytes300707 GTATTGATTTCAGCATTT-AACTGAGATAAGCG- P_pygmaeus300759 GTATTGATTTCAGCGTTT-AACTGAGATAAGCA- R_norvegicus300966 ATACTGATTTCAGCATTT-AACTGAGATAAGCT- S_araneus300440 ATACTGATTTCAGCATTT-AACTGAGANNNNNN- S_tridecemlineatus300274 ATAATGATTTCAGCATTT-AACTGAGATAAGCT- T_nigroviridis300040 ATTGTGATTCATTTCAATGCACTGAGACAAGAC- T_nigroviridis300041 AT-GTGAAATCATTCTTGTCTCTGAGGTGAGCT- ** *****

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved