snOPY snoRNA Orthological Gene Database

Family: SNORD71

CLUSTAL 2.0.10 multiple sequence alignment E_telfairi300750 TGTGTGCTGGAGGATGAAAACAAGGAGTGATCCATCGGCTGAGTGTCCTTTCACAATGTC E_caballus300250 TGTGTGTTGGAGGATGAAAATATGGAGTGATCCATCGGCTAAGTGTTTTATCACGATGCT F_catus300295 GGTGTGCTGGAGGATGAAAATACGGAGTGATCCATCGGCTAAGTGATTTATCACAATGCT H_sapiens300771 TGTGTGTTGGAGGATGAAAGTACGGAGTGATCCATCGGCTAAGTGTCTTGTCACAATGCT L_africana300482 TGTGTGCTGGAGGATGAAAATAAGGAGTGATCCATCGGCTAAGTGTCTTATCACAATGCT M_domestica300135 TGTGTGTTGGAGGATGAAAACTTTGAGTGATCCATCGGCTGAGTGATTTGTCACAATGCT M_musculus300812 CGTGTGCTGGAGGATGAAG-TAAGGAGTGATCCATCGGCTAAGTGTTTTCCCACTGTGCT O_anatinus302358 TGTGTGTTGGAGGATGAAAACTTTGAGTGATCCATCGGCTAAGTGACCTGTCACAGTGCT R_norvegicus300979 TGTGTGCTGGAGGATGAAG-CAAGGAGTGATCCATCGGCTAAGTGTTTACC-ACTGTGCT ***** *********** **************** **** ** ** E_telfairi300750 GAAACTCGAA-TTGCTGACAGCACACA E_caballus300250 GAAACTCAAA-CTGCTGACAGCACACG F_catus300295 GAAACTCATA-TTGCTGACAGCACACA H_sapiens300771 GACACTCAAA-CTGCTGACAGCACACG L_africana300482 GAAACTCGAA-TTGCTGACAGCACACA M_domestica300135 GAGACTCAAG-TTGCTGACAGCACACA M_musculus300812 GACACTCACA-TTGCTGACAGTGCACG O_anatinus302358 GAGACTCAAAACTGCTGACAACACACT R_norvegicus300979 GAAACTCACA-TTGCTGACAGCGCACT ** **** ******** ***

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved