snOPY snoRNA Orthological Gene Database

Family: SNORD67

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300113 --------------------TCAAGTGCTGTGAAGAGAACGTGCCACTGTACTTTGCCC- C_familiaris300460 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCAGAGTATCAGGTGATACAGGCACC- C_porcellus300892 TGTGAGTATGATGAGTTGCAC--ACTGGTGGAGCCACAGTGTCAGGTGATACAGGCACC- D_novemcinctus300542 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCATGGTATCAGGTGATACAAGCCCCC E_telfairi300822 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCACAGTATCAGGTGATACAGGCGCC- E_caballus300386 TGTGAGAGTGATGAGTTGCAC--AATGGTGAAGCCACAGTATCAGGTGATACGGGCATC- E_europaeus300577 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCACTGTATCAGGTGATACAGGCGCT- F_catus300262 TGTGAGAATGATGAGTTGCAC--ACTGGTGGTGCCACAGTGTCCGGTGACACGGGCACC- G_gallus300091 TGCGAGAGTGATGAGCTGCAC--TCTGGTGGAGCAACCATGTCAGGTGACGTGGTCTCT- H_sapiens300738 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCATGGTATCAGGTGATACAGGCACC- M_mulatta300646 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCATGGTATCAGGTGATACAGGCACC- M_murinus300555 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCATGGTATCAGGTGATACAGGCACC- M_domestica300178 TGTGAGAGTGATGAGTTGCAC--ATTAGTGTGGCCATAGCATCAGGTGATGCAGGCTAT- M_musculus300976 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCATAGTATCAGGTGATACAGGCACC- O_anatinus302247 TGTGAGGGTGATGAGTTGCAC--ACTGGTGGAGCCAAAGCATCGGTCGATGTGGGCGCC- O_garnettii300600 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCATGGTATCAGGTGATACAGGCACC- P_troglodytes300664 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCATGGTATCAGGTGATACAGGCACC- P_pygmaeus300733 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCATGGTATCAGGTGATACAGGCACC- R_norvegicus300945 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCATAGTATCAGGTGATACAGGCACC- S_araneus301022 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGAGCCA-AGTATCAGGTGATACAGGCACC- T_nigroviridis300045 TTTGAGAGTGATGAGTTGCACGAATCAGTTGGGGCGCTCGGTGCAGTGGCAACGGCGCC- T_belangeri300397 TGTGAGAGTGATGAGTTGCAC--ACTGGTGGGGCAACGGTGTCAGGTGATACCAGCACC- X_tropicalis300031 TTGGAGTATGATGAGTTGCACTAAAGGGAGAGGCGGTGCTGTGTACTGCCAA--ACCCG- X_tropicalis300078 TTGGAGTATGATGAGTTGCACTAAAGGGAGAGGCGGTGCTGTGTACTGCCAA--ACCCG- * C_elegans300113 -ATCGGA-AGGGCATTGAAATGGAGATATACCTGGCACAGGGGCCATCTGAGCACTT C_familiaris300460 ACTCAGT-ACCACCCTGGTGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA C_porcellus300892 ACTCAGT-ACCACCCTGGTGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA D_novemcinctus300542 ACTCAGT-ATTACTCTGTTGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA E_telfairi300822 ACTCAGT-ACCACCCTGGTGACAAAATCATG--TGCACAGGGGCCATCTGACTCACT E_caballus300386 ACTCAGT-ACCACCCTGGTGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA E_europaeus300577 GCTCAGT-ACCACCCTGGCGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA F_catus300262 AGTCAGTTACCACCCTGGTGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA G_gallus300091 GCTCAGA-ATCTCCCTGATGACAAAACTAGG--TGCACAGGGGCCATCTGACTCGCT H_sapiens300738 ACTCAGT-ATCACCCTGGTGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA M_mulatta300646 ACTCAGT-ATCACCCTGGTGACAAAATCAAG--TGCACAGGGGCCATCTGATTCACA M_murinus300555 ACTCAGT-ACCACCCTGGTGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA M_domestica300178 ACTCAGT-AATAAACTGGTGACAAAGCCATG--TGCACAGGGGCCATCTGACTCGCA M_musculus300976 ACTCAGT-ACTACCCTGGTGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA O_anatinus302247 GCTCAGT-ATCACCTTGGTGACAGAACCAGG--TGCACAGGGGCCATCTGACTCTCA O_garnettii300600 TCTCAGT-ACCACCCTGATGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA P_troglodytes300664 ACTCAGT-ATCACCCTGGTGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA P_pygmaeus300733 ACTCAGT-ATCACCCTGGTGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA R_norvegicus300945 ACTCAGT-ACCACCCTGGTGACAAA-CCAAG--TGCACAGGGGCCATCTGACTCACA S_araneus301022 ACTCAGT-ATCACCCTGTTGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA T_nigroviridis300045 --CCAGTCCGAGCAGCGCTGAGGACACCCTGGGTGCACAGGGGCCATCTGACTCAAC T_belangeri300397 ACTCAGT-ACCACCCTGGTGACAAAATCAAG--TGCACAGGGGCCATCTGACTCACA X_tropicalis300031 --ACAGACCCAG-ACTGGTGACAGAACCATG--TGCACAGGGGCCATCTGACTCCAT X_tropicalis300078 --ACAGACCCAG-ACTGGTGACAGAACCATG--TGCACAGGGGCCATCTGACTCCAT * * * *****************

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved