snOPY snoRNA Orthological Gene Database

Family: SNORD65

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300084 ----AGGTTG-GGTTACTTGTTACAATATAGCT---GTGAAGTGCT-ATA C_familiaris300085 ------ATGCAGGAT-CTAGTTACAATGTAGCT---ATAAAGTGCT-GCC C_familiaris300136 ------AAGCAGGATACAGACTACAGTAAAGCTG--TTAAG-TGCT-GTA C_familiaris300144 -------TATTAGGATTAAAA--GAGGAGAT-A---CAA--GTGCT-GTG C_familiaris300423 ------AAGCAGGATTTAGACTACAATATAGCT---GTTAAGTGCT-GTG C_familiaris300458 -------GTTTGGATTTAGACTACAACATAGCT---GTTAAGTGCT-GTA C_familiaris300459 -------------------AAAAATAAATTA-A---AAAAAATAAA-ATA C_porcellus300001 ------ATGTCAT-ATTAAAACTGAAGGGAT-G---TAAA-GTGCT-GTG C_porcellus300507 CGGCAGGTTG-GG----ATGTCACAGTGTAGCT---GGGAAGTGCT-ATA C_porcellus300508 ------AGGCAGGAT-CTAGGTACAGTGTAGCG---TTGAAGTGCT-GCA C_porcellus300555 -------------------------AGGCAG-G---TGCTTATCCC-GCT C_porcellus300556 ------AAGCAGGATTCAGACTACAACATGGCT---GTAAAGTGCT-GTG C_porcellus300879 ------ATGCAGGT--ACAGTTACAATATAACT---GAAGTGT-TC--TA C_porcellus300880 ------AAGCAGGATTCAGACTACAGCATGGCT---GTAAAGTGCT-GTG C_porcellus300889 -------------ATCCATTTCCCTATAAAA-G---CCTCAAGTTT-ATC C_porcellus300926 ------AAGCAGGATTCAGACTACAATATAGCT---GTTACGTGCT-GTG C_porcellus300927 ------AAGCAGAATTCAGACTACAACATGGCT---GTTAAGTGCT-GTG D_rerio300107 ------GTGCAGGTT---ATCTACGGACTGGCTG--TTGCAGTGCTTGT- D_rerio300108 ------GTGCAGGTT-T-AGTTACGGACTGGCTG--TTGCAGTGCTTGT- D_rerio300109 ------GTGCAGGTT-C-AGTTATGGACAGGCTG--TCGCAGTGCTTGT- D_rerio300110 ------GTGCAGGTT-T-AGTTACGGACTGGCTG--TTGCAGTGCTTGT- D_rerio300111 ------GTGCAGGTT-C-AGTTATGGACAGGCTG--TTGCAGTGCTTGT- D_novemcinctus300052 ----------------------ATTCCAGTA-A---AATTTTATTT-ACA D_novemcinctus300309 ------AAGCAGGGATTAGACTACAATACATCT---GTTCAGTGCT-GTG D_novemcinctus300322 -------AGCAGGATTTAGACTACAATATAGCTG--TTCAG-TGCT-GTC D_novemcinctus300470 ------ATGCAGGTT-CTAGCTACAATGCAGCT---GTGAAGTGCT-GCA D_novemcinctus300487 ------AAGCAGGATTTAGACTACAATTTAGCG---GTTCATTGCT-GTG D_novemcinctus300536 ----------------TTACATATTATATATTC---TTTTAAAAGA-ATT D_novemcinctus300557 ------AAGCAGGATTTAGACTACAATATAGCT---GTTCAGTGCT-GTG D_melanogaster300232 ---TCACAGTACTGACAAATTAACTGGTTTGAA----ACCATCACCAGGG D_melanogaster300235 ---TCACAGTACTGACAAATTGACGGGCTTGAA----AAAGTCGCCTGTA D_melanogaster300237 ---ACACAGTACCCTGACACCTAACTGTTAGAGCGTCGATAGAGTTTGGC E_telfairi300013 ------CAGCAGGATTTAGACTGCAATATAGCT---GTTTAGTGCT-ATT E_telfairi300017 ------CAGCAGGATTTAGACTACAATATAGCT---GTTAAGTGCT-AAT E_telfairi300053 ------CAGCAGGATTCCGATGACGATATAGTT---GTTTAGTGCT-ATT E_telfairi300065 ------------ACTCAAGTATATATGGTATCT---GTTTAGTGGT-ATT E_telfairi300068 ------CAGCAGGATTTAGACTACGATATAGCT---GTTAAGTGCT-ATT E_telfairi300100 TGGCGGGTAA-AGTCAATACTTACAGTATAGCT---GTGCAGTGCT-CAA E_telfairi300183 ------CAGCAGGATTTAGACTACAATATAGCA---GTTAAGTGCT-AAT E_telfairi300262 ------CAGCAGGATTTAGACTACAATATAGCT---GTTAAGTGCT-ATT E_telfairi300278 ------TCGTTGTGATCAGACGACAATATAGCT---GTTTAGTGCT-ATT E_telfairi300286 ----------AGACATGTTTCTACAATATAGCT---GTTAAGTGCT-ATT E_telfairi300287 ----------AGACATGTTTCTACAATATAGCT---GTTAAGTGCT-ATT E_telfairi300290 ------CAGCAGGATTTAGACTACAATACAGCT---GTTAAGTCCT-ATT E_telfairi300296 ------CAGCAGGATTTAGACTACAATATAGCT---GTTAAGTGTT-ATT E_telfairi300376 -------ATGCTCGACAGGACTACAATATAGCC---GTTTAGTGCT-ATT E_telfairi300493 ------CAGCAGGATTTAGACTACAATATAGCT---GTTAAGTGCT-ATT E_telfairi300503 ------CAGCAGGATTTAGACTACAATACAGCT---GTTAAGTTCT-ATT E_telfairi300567 ------CAGCAGGATTTAGACTACAATACAGCT---GTTAAGTGCT-ATT E_telfairi300588 ------CAGCAGGATTTAGACTACAATATAGCT---GTTAAGTGCT-ATT E_telfairi300628 ------CAGCAGGGT-TAGATTACAATATAGAT---GCTCAGTGCT-ATG E_telfairi300660 ------CAGCAGGATTTAGACTACAATATAGCG---GTTAAGTGCT-ATT E_telfairi300682 ------CAGCAGGATTTAGACTACAATATAGCT---GTTTAGTGCT-ATT E_telfairi300774 ------CAGCAGGATTTAGACTACAATATAGCT---GTTAAGTGCT-ATT E_telfairi300781 ------CAGCAGGATTTAGACTACAATATAGCT---GTTAAGTGCT-ATT E_telfairi300785 ------CAGCAGGATTTAGACTACAATATAGCT---GTTAAGTGCT-ATT E_telfairi300798 ------CAGCAGGGTTTAGACTACACTATAGCT---GTTTAGTACT-ATC E_caballus300140 TGGCAGGTTAAGGTTGATTGTTACAGTATAGCT---GTGCAGTGCT-ATA E_caballus300141 ------ACGCAGGAT-CTACTTACAATGCAGCT---GTGAAGTGCC-GCA E_caballus300347 -----AATGAGGGT--ACTGTTACAAAACAACT---GAAGTGT-TG--TA E_caballus300348 ------AAGCAGGATTTAGACTACAATATAGCT---GTTAAGTGCT-GTG E_europaeus300182 ----AGGTCG-GGATAATTGTTACAGTATAGCT---GTCAAGTGCT-ATA E_europaeus300183 ------ATGCAGGA---TACTTACAATGTAGCT---GTGAAGTGCT-GCA E_europaeus300295 ------ATGCAGAATTTACACTGCTATCTAT-A---TGTAAGTGCT-GAG E_europaeus300413 ------AAGCAGGATTTAGACTACAATATAGCT---GTCT-GTGCT-GTG E_europaeus300452 ------AAGCAGGA--AATGTTACAATACAACT---GTAGTGT-TC--TA E_europaeus300574 ------AAGCAGGA--AATGTTACAATACAACT---GTAGTGT-TT--TA E_europaeus300575 ------CAGCAGGATTTAGACTACAATATGGCT---GTCA-GTGCT-GTG F_catus300104 ------ATGCAGGAT-GTAGTTACAATGTAGCT---GTAAAGTGCT-GCC G_gallus300112 ------AAGCAGGAT-A-AGTTATGATATAGCT---GTGCAGTGCT-GTA G_aculeatus300135 ------AAGCAGGAT-A-AGTTACAATGCAGTTA--GTGGAGTACT-GCT G_aculeatus300136 ------AAGCAGGAT-A-AGTTACAATGCAGCTT--GTGAAGTACT-GCT G_aculeatus300137 ------AAGCAGGAT-A-AGTTACAATGCAGCTT--GTGAAGTACT-GCT G_aculeatus300138 ------AAGCAGGAT-A-AGTTACAATGCAGTTA--GTGGAGTACT-GCT H_sapiens300229 ------AGGCAGGT--ACTGTTAGAATATAACT---GAAGTGT-TT--TA H_sapiens300616 -----AAAGCAGGATTCAGACTACAATATAGCT---GCTAAGTGCT-GTG H_sapiens300659 ------AAGCAGGATTCAGACTACAATATAGCT---GTTAAGTGCT-GTA L_africana300457 ------ACGCAGGT--ACTGTTAAAGTATAACT---GAAGTGT-TT---A L_africana300458 ------TAGCAGGATTTAGACTACAATATAGCT---GTTAAGTGCT-GTG M_mulatta300131 ----AGGTTG-GATTCATTGTTACAACATAGCT---GTGAAGTGCT-ACG M_mulatta300181 ------ATGCACGT--ACTGCTACAGTATGACT---AAAGTGA-TT--TG M_mulatta300251 ------GTGCATGT--ACTGTTACAATCTAACT---GAAGCAT-TT--TA M_mulatta300385 ------AAGCAGGATTCAGACTAGAATATAGCT---GTTAAGTGCT-GTG M_mulatta300449 ------AGGCAGGT--ACTTTTAGAATATAATT---GAAGTGT-TT--TA M_mulatta300576 ------AAGCAAGACTCAGGCTACAATATAGCT---GTTAAGTGCT-GTG M_mulatta300608 ------ATGCAGGT--ACTGTTACAATACAACT---GACGTGT-TT--TA M_mulatta300609 ------AAGCAGGATTCAGACTACAATATAGCT---GCTAAGTGCT-GTG M_murinus300175 ------ACACATGT--ACCGTTACAATATAACT---GAAGTGT-TT--TA M_murinus300178 ------ATGCAGGT--ACTGTTACAATATAACT---GAAGTGT-TT--TG M_murinus300182 ------ATTCAGGT--ACTGTTATAGTATAACT---GAAGTGT-CT--TA M_murinus300234 ------ATGCAGGAT-CTAGTTACAATGTAGCT---GTGAAGTGCA-GCA M_murinus300293 ------AAGCAAGATTCAGACTACAATATAGCT---GTTAAGGGCT-ATG M_murinus300344 ------CAGCAGGT--ACTGTTACAATATAACT---GAAGTGT-TA-ATA M_murinus300396 ----AGGCTG-GGTTAATTGTTACAGTATAGCT---GTGCAGTGCT-ATA M_murinus300445 ------ATGTGGGT--ACTATTACAATATAATT---GAAGTGT-TT--TA M_murinus300492 ------CAGCAGGT--ACTGTTACAATATAACT---GAAGTGT-TA-ATA M_domestica300183 ------ATGCAGGA-ACTAGTTACAATATAGCA---GTGAAGTGCT-TTA M_domestica300184 ------TTGCAGGTT-CAAGTTACAATATGGCTG--TGAAAGTGCCCATA M_musculus300074 ------------TT--TCAGTTACTATACAACT---GAAGTGT-TT--TA M_musculus300555 ------ATGCAGGT--ACAGTTACAAT--------------GT-TT--CA M_musculus300643 -------------ACTTTAAAGTTAACATAT-T---TACATATGCT-GTG M_musculus300742 ------GAGCAGGAT-CAATGTACAATGTAGCT---GTAAAGTGCT-ACA M_musculus300874 ------ATGCAGGT--ACAGTTACAATAAAACT---GAAGTGT-TC--TA M_musculus300875 ------AAGCAGGATTTA-ACTACAATATAGCT---GCTCAGTGCT-GTG O_anatinus303697 ------ACGCGGGTT-CCGGTTACGGTGTAGCCG--CGGA-GCGCC-GTG O_cuniculus300025 ----AGGTGG-GGTCAGTGGTTACTGTGTAGCT---GTGAAGTGCT-GCA O_cuniculus300217 ------AAGCAGGATTCAGACTACAGTATAGCTG--TTTAGCTGCT-GGA O_cuniculus300272 ------AAGCAGGATTCAGACTATAATATAACTG--TTTAG-TGTT-GTG O_cuniculus300295 ------AAGCAGGATTCAGGCTGTAGTATG--TG--TTTAG-TGCT-GTG O_cuniculus300300 ------AAGCAGATT-CAGACTACACTGTAGCT---ATTTAGT-CT-GCA O_cuniculus300334 ------AAGCAAAATTCAGACTACAATATGGCT---GTTTAGTGCT-GTG O_cuniculus300371 ------------ATGCCGGCACTGCAGACAG-T---GGCTTTACCC-GCT O_cuniculus300372 ------AGGTAGGATTCAGATTACAAAATAGAT---GTTTCGTGCT-GTG O_cuniculus300446 ------AAGCAGGATTCAGACTACAGTATAGCT---GTTGAGTGTT-GGG O_cuniculus300502 ------ACACAGGT--GCAGTTAGAACATAACT---GAAGTGT-TT--TA O_cuniculus300503 ------AAGCAGGATTCAGACTACA-TATAGCT---GTTTAGTGCT-GTG O_latipes300064 ------TAGCAGGAT-A-T-CTACTGTGCAGCTT--GTGTGGTGCT-GCA O_latipes300065 ------GTGCAGGAT-A-AGTTACAATGCAGCT---GTGTAGTACT-GTA O_garnettii300144 ------GTGAAGAT--ACTATTACAGTATAATT---GAAATGT-TT--TA O_garnettii300420 ------ATGCAGGT--ATTGTTACAATATAACT---GAAGTGT-TT--TA O_garnettii300460 ------ATGCAGGAT-GTAGTCACAATGTAGCT---GTGAAGTGCA-GCA O_garnettii300598 -------AAAAAAAATTAATATATAATATAGCT---ATAAAGTGCT-GTG O_garnettii300682 ------ATGCAGGT--CCTGTTACAATATAACT---GAGGTGT-TA-ATA P_troglodytes300109 ------AGGCAGGT--ACTGTTAGAATATAACT---GAAGTGT-TT--TA P_troglodytes300165 ------GTGCATGT--ACTGATACAATCTAACT---GAAGTAT-TT--TA P_troglodytes300170 ------ATGCAGGT--ACTGTTACAATATGACT---GAAGTGA-TT--TG P_troglodytes300344 ------ACGCAGGATTCAGACTAGAATATAGCT---GTTAAGTGCT-GTG P_troglodytes300348 --------------------------------------AAAAAAAA-AAA P_troglodytes300349 ----AGGTTG-GATTCATTGTTACAATATAGCT---GTGAAGTGCT-ATG P_troglodytes300350 ------AGGCAGGAT-CTAGTTACATTGTAGCT---GTGAAGTGCT-GCA P_troglodytes300370 ------ATGCAGGT--ACTGTTA-----CAACT---GAAGTGT-TT--TA P_troglodytes300519 --------GTGGAGNNNNNNNNNNGGATTCG-C---TGTTAGTGCT-GTG P_troglodytes300632 ------ATGCAGGT--ACTGTTACAATACAACT---GACGTGT-TT--TA P_troglodytes300633 ------AAGCAGGATTCAGACTACAGTATAGCT---GCTAAGTGCT-GTG P_pygmaeus300093 ------ACGCAGGATTCAGACTAGAATATAGCT---GTTAAGTGCT-GTG P_pygmaeus300129 ------ATGCAGGT--ACTGTTA-----TAACT---GAAGTGT-TT--TA P_pygmaeus300181 -----------------------------AA-A---AAAAAAAAAA-AAA P_pygmaeus300202 ------GTGCATGT--ACCATTACAATCTAACT---GAAGTAT-TT--TA P_pygmaeus300254 ------AGGCAAGT--ACTGTTAGAATATAACT---GAAGTAT-TT--TA P_pygmaeus300333 --------------------------------------AAAAAAAA-AAA P_pygmaeus300349 ------ATGCAGGT--ACTGTTACGATATGACT---GAAGTGA-TT--TG P_pygmaeus300431 ----AGGTTG-GATTCATTGTTACAATATAGCT---GTGAAGTGCT-ATG P_pygmaeus300432 ------AGGCAGGAT-CTAGTTACATTGTAGCT---GTGAAGTGCT-GCA P_pygmaeus300435 ------AGGCAGGT--ACTGTTAGAATATAACT---GAAGTAT-TT--TA P_pygmaeus300599 ------AAGCAGGATTCAGACTACAATATAGCT---GTTAAGTGCT-GTA P_pygmaeus300728 ------ATGCAGGT--ACTGTTACAATACAACT---GACGTGT-TT--TA P_pygmaeus300729 ------AAGCAGGATTCAGACTACAATATAGCT---GTTAAGTGCT-GTG R_norvegicus300080 ------ATGCAGGT--ACAGTTACACTAAAACT---GAAGTGT-TC--TA R_norvegicus300150 -----------------------CAGCAC-T-G---AAAAGAAGAA-AGA R_norvegicus300810 ------GAGCAGGAT-CTAGGTACAGTGTAGCG---GTGAAGTGCT-GCA R_norvegicus300983 ------CTTCGGGT--ACAGTTACAATGTAACT---GAAGTGT-TC--TA R_norvegicus301034 ------AAGCAGGATTTT-ACTACAATATGGCT---GCTCAGTGCT-GTG R_norvegicus301035 ------ATGCAGGT--ACAGTTACAATAAAACT---GAAGTGT-TC--TA S_araneus300078 ------AAACAGGATTTAGACTACAATATAAGC---TCTAAGTTTT-GTG S_araneus300154 -------AAGAGGATTTTAACTACAGTATAGAA---TATAAAGGTT-GTG S_araneus300972 ------ATGCAGGA--ACTGTTACAATACAACT---GAAAAGTGTT-CTA S_araneus300973 ------AAGCAGGATTTAGACTACAATATAGCT---GT-AAGTGCT-GTG S_araneus300990 ------AAGCAGAATTTAGTCTACAGTTTAG-C---TGTGAGTGCT-AT- S_tridecemlineatus300133 TGGCAGGTTG-GGT---ATGTGGCACTATAGCT---GCAAAGTGCT-ATA S_tridecemlineatus300134 ------AAGCAGGAT-CTAGTTACAATGTAGCC---ATGAAGTGCT-TCA S_tridecemlineatus300271 ------GAGCAAGATTCAGACTAGAATATAGCT---GTTAAGTGCT-GTA T_nigroviridis300071 ------ATGCAGGTT-A-GGTTACAACGCAGCCT--GTGAAGTGCT-GTT T_nigroviridis300072 ------TAGCAGGAT-A-AGTTACAGTGCAGCTT--GTGAAGTGCT-GTG T_belangeri300085 ------AAGCAGAATTCAGACTACAATATAGCT---GTTAAGTGCG-ATG T_belangeri300126 TGGCAGGTTG-GGT---G-GTTTCGATATGGCT---GTGAAGTGCT-GTG T_belangeri300177 ------AAGCAGGATTTAGACTATAATAAATCT---GTTAAGTGCT-GTG T_belangeri300272 ------GAGCCGGATTCAGACCACAATATAGCT---GTTAAGCGCT-GTG T_belangeri300390 ------ATGCAGGT--ACTGTTACAATATAACT---GAAGTGT-TT--TA T_belangeri300391 ------AAGCAGGATTTAGACTACAATATAGCT---GTTAAGTGCT-GTG X_tropicalis300061 ------CTGCAGGAT-T-AGTTACAATACATCT---GTGCAGTGCT-GTG X_tropicalis300117 ------ATGCAGGAT-A-AGTTACAATATAGCT---GGGCAGTGCT-GTG C_familiaris300084 TTGTCCTTACCC-C-TGCTGAAA--GCAACT-------GTTTCCTACAAT C_familiaris300085 TTGTCTTTACCC-CCTGCTCAAAATAAAACT------GTTATCTTTCTAG C_familiaris300136 CTGTACCTCCTC--CTGCTCAAAACAAAGTT------GTTTCCTAACTAT C_familiaris300144 TTGTCGTTCCCC-C-TGCTCAAAATAAA------GCTGTTTCTTAACTA- C_familiaris300423 TTGT-CGTTCCC-CCTGCTCAAAATAAAGCT------GTTTCTTAACTAT C_familiaris300458 TTGT-CATTCCC-TCTGCTCAAAATAAAGTT------GTTTCTTCCATC- C_familiaris300459 AAATAAAACCAC-A-CACACAAAAAAAG-------TTGTTTCTTGACTG- C_porcellus300001 CTGTCATTCCCC-C-AGCTCAAAATAAA------GTTGTTTCTTAACTG- C_porcellus300507 TTGTTCTGTCCC-CCTGCCAAGA--GGAAGT-------GTTTCCCACAAT C_porcellus300508 TTGTGTGTGTTT-CCTGCTCTAAATAAAACT------GTCACCTTCCTGG C_porcellus300555 GAGCTAAATCCC-C-AGCCCCAATAAAC-------TTGTTTCTTAACTA- C_porcellus300556 GTGT-CATTCCT-CCTGCTCAAAATAAGCTT------TTTTTTTTTTTTT C_porcellus300879 TTGT-CGTTCCC-CCTGCTTAAA--GTATTT------GATACATTACTAT C_porcellus300880 TTGT-CGTTCCC-CCTGCTCAAAATAAAGTT------GTTTCTTAACTAT C_porcellus300889 TTTCCTTATAAC-T-GAG--TAATAAAG-------TTGTTTCTTAATTA- C_porcellus300926 TTGT-CATTCTG-GCTGCTCAAAATACAGTT------GTTTCTTGGGGCT C_porcellus300927 CTGT-CGTTCCC-CCTGCTAAAAATAAAGTT------GTTTCTTTTTTTT D_rerio300107 TTGT-CGTTCCC-CCTGCAGAAA--TAAACA-----TGATTCCT-TCTAT D_rerio300108 TCGT-CGTTCCC-CCTGCAGACA--TAAACA-----TGTTTCCT-ACTAT D_rerio300109 TCGT-CGTTCCC-CCTGCACAAA--TGAACA-----TGATTCCT-TCTAT D_rerio300110 TCGT-CGTTCCC-CCTGCAGAAA--TAAACA-----TGTTTCCT-ACTAT D_rerio300111 TCGT-CGTTCCC-CCTGCACAAA--TGAACA-----TGATTCCT-TCTAT D_novemcinctus300052 AAAACA-GCCTC-C-TGCTAAAATAAAG-------TTGTTTCTTATCTA- D_novemcinctus300309 TTGT-CATTCCC-CCTGCTAATAATAAA-GT-----TGTTTCTTATCTAT D_novemcinctus300322 TTGTCATTTT--------------------------------------AT D_novemcinctus300470 CTGTGTTTGTCC-C-TGCTCAAAATGAAACT------GTT-CCTTTCCAG D_novemcinctus300487 TCAT-CATTCCT-CCTGCTAAAAATGAAATT-----ATTTTTTAACCTAT D_novemcinctus300536 TTGT-C---CCC--CTGCTAAAA--ATAAAGT----TGTTTCTTATTTAT D_novemcinctus300557 TTGT-CGTTCCC-CCTGCTAAAAATAAAAGT-----TGTTTCTTATCTAT D_melanogaster300232 TAGTTTTTTTTTAAACGCTGTGAGATGAATTAAAGCGTCGGCTAAGCTAT D_melanogaster300235 TGGTTTTTATTTAAACGCTGTGAGATTAATTTAAGCGTCGGCTAAGCTAT D_melanogaster300237 AGTTAGCTTATTAAACGCTGTGAGATCAACTGACG-ATGGCCTTCGCTAT E_telfairi300013 TT-T-CATTCCC-CCTGCTCAAA--GTACAGC----TGTTTCTTATCTAT E_telfairi300017 TTGT-TGTTCCC-CCAACTCAAAA-GTAAAGT----TGTTTCCTATCTAC E_telfairi300053 TTAT-TGTTCCC--CTGCTCAAA--GTAGAGT----TGTTTCTTAGCAGT E_telfairi300065 TTGT-CGTTCCT-CCTGCTCAAAATAAAGTT------GTTGTTTTTCTAT E_telfairi300068 TTGT-CGTTCCC-CCTGCTCAAA--GTAAAGT----CCTTTCTTATCTAT E_telfairi300100 TTGTCTTTTCTC-CCAGCTCAAA--GCA-TT-------GCTTCCTGCAGT E_telfairi300183 TTGT-CGTTCCC-CATGCTCAAA--GTAAAGT----TGTTTCTTATCTAT E_telfairi300262 TTGT-CATCCTC-CCTCCTCAAA--GTAAAGC----AGTTTCTTATCTAT E_telfairi300278 TTGT-CATTCCC-CCTGCTCAAA--GTAAAGT----TGTTTCTTAGCTAT E_telfairi300286 TTGT-CGTTCCC--CTGCTCAAA--GTAAAGT----TGGTTCTTATCTAT E_telfairi300287 TTGT-CGTTCCC--CTGCTCAAA--GTAAAGT----TGGTTCTTATCTAT E_telfairi300290 TTGT-CATTCCC-CCTGCTCAAA--GTAAAAT----TGTTTCTTATCTAT E_telfairi300296 TTGT-CGTTCCC-CCTGCTCAAA--GTAAAGT----TGTTTCTTATCTAT E_telfairi300376 TTGT-CGTTCCC-GCTGCTCAAA--GTAAAGT----TGTTTCTTATCTAT E_telfairi300493 TTCT-CATTCCC-CCTGATCGAA--GTAAAGT----TGTTTCTTATCTAT E_telfairi300503 TTGT-CGTTCCC-CCTGCTCAAA--GTAAAGT----TGTTTCTTATCTAT E_telfairi300567 TTGT-CATTCCC-CCTGCTCAAA--GTAATGT----TGTTTCTTATCTGT E_telfairi300588 TTGT-CGTTCCC-CCTGCTCAAA--GTAAAGT----TGTTTCTTATCTAT E_telfairi300628 TTGT-TGTTCCATCCT-CTCAGA--GAA---------GTTTCTTTTCTAA E_telfairi300660 TTGC-CATTCCC-CCTGCTCAAA--GTAAAGT----TGTTTGTTATCTAT E_telfairi300682 TTGT-CGTTCCC-CCTGCTCAAA--GTAAAGC----TGTTTCTTATCTAT E_telfairi300774 TT-T-CATTCCC-CCTGCTCAAA--GTAAAGT----TGTTTCTTATCTAT E_telfairi300781 TTGT-CGTTCCC-CCTGCTCAAA--GTAAAGT----TGTTTCTTATCTAT E_telfairi300785 TTGT-CGTTCCC-CCTGCTCAAA--GTAAAGT----TGTTTCTTAACTAT E_telfairi300798 TTGT-CGTTCTC-CCTGCTCAAA--GTAAAGT----TCTTTCTTATCTAT E_caballus300140 TTGTCCTTGCCC-C-TGCTGAAA--GCAATT-------GTTTCCTACAAT E_caballus300141 TTGTCCTTGGCG-CCTGCTCAAAATAAAACT------GTTACCCTTCAGC E_caballus300347 TTGT-CGTT----TCTCCTTGGA--GCAATG------GATGCATAACTGT E_caballus300348 TTGT-CGTTCCC-CCTGCTCAAAATAAAGTT------GTTTCTTAACTAT E_europaeus300182 TTGTCCCACCC--CCTGCTGAAA--GTAAGT-------GTTTCCTACAAT E_europaeus300183 TTGCCTTTGCCC-CCTGCTTAAAGCATAGTT------GGTACCGTCCTAG E_europaeus300295 CTGTCATTCCCT-C-TCCTTAAAATGAA-------TTGCTTCTTAACTA- E_europaeus300413 TTGT-TGTTCCT-CCTGCTGAAAAACAAAGC------GTTTCTCTACTAT E_europaeus300452 TTGT-CGTTCCC-CCTGCTTAGA--GCAACT------GATGCAT-ACTAT E_europaeus300574 TTGT-CGTTCCC-CCTGCTTAGA--GCAACT------GATGCAT-ACTAT E_europaeus300575 TTGT-CGTTCCC-CCTGCTGAAAA-CAAAGT------GTTTCTTTACTAT F_catus300104 TTGTCTTTACCC-C-TGCTCAAAATAAAACT------GTTACCTTTCTAG G_gallus300112 TTAT-CGTTCCC-CCTGCTTAAA--GAAAAA-----TGTTTCCT-TCTAT G_aculeatus300135 TTGT-CGTTCCC-CCTGCACACA--ATAACC-----TGTTTCCACGCTAT G_aculeatus300136 TTGT-CGTTCCC-CCTGCAAACA--ATAACC-----TGTTTCCACGCTAT G_aculeatus300137 TTGT-CGTTCCC-CCTGCAAACA--ATAACC-----TGTTTCCACGCTAT G_aculeatus300138 TTGT-CGTTCCC-CCTGCACACA--ATAACC-----TGTTTCCACGCTAT H_sapiens300229 TTGT-TATTGTC-ATTGCTTAAA--GCATTG------GATACATAACTAT H_sapiens300616 TTGT-CGTTCCC-CCTGCTTAAAATAAAGTT------GTTTCTTAACTAT H_sapiens300659 TTGTCATTCCC--CCTGCTCAAATTAAAGTTGT------TTCTTAACTA- L_africana300457 TTGT-CCTTTCC-CCTGCTTAAA--GCAACT------GATGTATAACTAT L_africana300458 TTGT-CGTTCCC-CCTGCTCAAAATAAAGTT------GTTTCTTATCTAT M_mulatta300131 TTGTCCTTATTC-CCTGCTGAAA--GCAATT-------GTTTCCCACAAT M_mulatta300181 TTGT-CATTTCC-CCTGCTTAAA--GCACTT------GATACATAACTAT M_mulatta300251 TTGT----TACC-CGTGCTTAAA--GCACTAT----AGATGCATAACTAT M_mulatta300385 TTGCCATTTCCC--CTGCTTAAAATAAAGT-----TTTTTTCTTAACTA- M_mulatta300449 TTAT-TATTTTC-ATTGCTTAAA--GCATTT------GACACATAACTAT M_mulatta300576 TTGTCATTCCC--CCTGCTCAAATTAAAGTTGT------TTCTTCACTA- M_mulatta300608 TTGT-CGTTCCC-CCTGCTTAAA--GCACTT------GATGCATAACTAT M_mulatta300609 TTGT-CGTTCCC-CCTGCTCAAAATAAAGTT------GTTTCTTAACTAT M_murinus300175 TTGT-TGTTATC-CCTGCTTATA--GCGTTT------GGTACATAACTAT M_murinus300178 TTGT-CATTCCC-CCTGCTTAAA--GCATTT------GATATTTAATTAT M_murinus300182 TTGT-CCTTCCC-CCTGCTTGAA--GCATTT------GATACATAACTAT M_murinus300234 TTGTCTTTGCCC-CCTGCTCAAAATAAAACT------GTTACCTTTCAAG M_murinus300293 TCGTCATTTCC--CCTGCTCAAAATAAAGTTGT------TTCTTAACTA- M_murinus300344 TTGT-CGTTCCT-CCTGCTTAAA--GCAATT------GATTGATAACTAT M_murinus300396 TTGTCCTTTCCC-CCTGCTGAAA--GCAATT-------GTTTCCCACAAT M_murinus300445 TTGT-TGTTCCC-CCTGCTTAAA--GCCTTT------GATACATAACTAT M_murinus300492 TTGT-CGTTCCC-CCTGCTTAAA--GCAATT------GATTCATAACTAT M_domestica300183 TTGT-CGTTCCC-CCTGCTTAAATCAAAATG--------TTTTTTACTAT M_domestica300184 TTGT-CGTTCCC-CCTGCTCAAA--GCAACA-----TGTTTCAT-ACTAT M_musculus300074 TTGC-AGTTCCC-TCTGCTTAAA--GCACTC------AATACATTACTAT M_musculus300555 TTGT-CTTTGCC-CCTGCTTAAA--GCATTT------GATGCATTACTAT M_musculus300643 TTGTCATTCCCC-C-TGCTCAGAATAACAGAATAATTGTTCCTTAACTA- M_musculus300742 TTGTTTT-ACTC-CCTGCTCAAAAGAAAAGT------GTTACCTTCCGAG M_musculus300874 TTGT-CGTTCCC-CCTGCTTAAA--GCATTT------GATACATTACTAT M_musculus300875 TTGT-CGTTCCC-CCTGCTCAGAATAA--TT------GTTTCTTAACTAT O_anatinus303697 TTGT-CGTTCCC-CCTGCCCAGA--GCAAAAAT---CGTCTCCT-ACCAT O_cuniculus300025 TTGTCCTT-CCC-CCTGCTGACA--GCAATT-------GTTTCCCACAAT O_cuniculus300217 TTGTCCTTCCTC--TTGCTCAAAGTAAGGTT------GTTTTCTTACTAT O_cuniculus300272 TTGC--TTTC--------------------------------------CC O_cuniculus300295 TTATCATCCTCC--CTGCTCAAAATAAGGTT------GTT--------TC O_cuniculus300300 TTGTTCTGCCCT--CTGCTCAAAATCAAGTGT------TTTCTTAACTGT O_cuniculus300334 TTGT-CGTTCCT-CCTGCTCAAAGTAAGGTT------GTTTCTTAACTAT O_cuniculus300371 AAGCCACAGTGC-T-GTCCCCAGG-----------TTGTTTCTTAACTA- O_cuniculus300372 TTGT-CATAACC-TTTGCTTAAAATAAAATT------TTTTCTTTCTTTC O_cuniculus300446 TTGT-CATTCCC-TCTGCTCAAAATAAGCTT------GTTTCTCAACTAT O_cuniculus300502 TTGT-TCC---C-CCTGCTTATACAACATTT------GATGCAGAATTAT O_cuniculus300503 TTGT-CGTTCCC-CCTGCTCAAAGTAAGGTT------GTTTCTTACTATN O_latipes300064 TTGT-CGTTCCC-CCTGCTGAAA--GTAACA-----TGTTTCCA-GCTAT O_latipes300065 TTGT-CGTTCCC-CCTGCAAACA--GTAAGC-----TGTTTCCTCGCTAT O_garnettii300144 TTAT-TGTTCCC-CATGCTTAAA--GCATTT------GATGCATAATTAT O_garnettii300420 TTAT-CATTCTT-TCTGCTTAAA--GCATTT------GATGTATAACTAT O_garnettii300460 TTGTCTTTGCCC-CCTGCTCAAAATAAAGCT------GTCACCTTTCAAG O_garnettii300598 TTTATTATTCCC-TTAGTTCAAAATAAA------GT-GTTTCTTAACTA- O_garnettii300682 TTGT-CGTTCCC-CCTGCTTAAA--GGAATT------GATACATAACTAT P_troglodytes300109 TTGT-TATTGTC-ATTGCTTAAA--GCATTG------GATACATAACTAT P_troglodytes300165 TTGT----TACC-CCTGCTTAAA--GCACTAT----AGATGCATAACTAT P_troglodytes300170 TTGT-CATTTCC-CCTGCTTAAA--GCACTT------GATATATAACTAT P_troglodytes300344 TTGTCATTCCCC--CTGCTTAAAATAAAGT-----TTTTTTCTTAACTA- P_troglodytes300348 AAGATAAATAAA-A-TA---AAATAAAG-------TTGTTTCTTAACTA- P_troglodytes300349 TTGTCCTTGCCC-CCTGCTCAAA--GCAATT-------GTTTCCCACAAT P_troglodytes300350 TTGTCTTTGCCC-CCTGCTCAAAATAAAACT------GTTACCTTTCAAG P_troglodytes300370 CGGTTTTTTCTT-CCTGCTTAAA--GCACTT------GGTACATAAGTAT P_troglodytes300519 TTGTCATTCCCC-C-TGCTCAATTAAAG-------TTGCTTCTTAACTA- P_troglodytes300632 TTGT-CGTTCCC-CCTGCTTAAA--GCACTT------GATGCATAACTCT P_troglodytes300633 TTGT-CGTTCCC-CCTGCTTAAAATAAAGTT------GTTTCTTAACTAT P_pygmaeus300093 TTGTCATTCCCC--CTGCTTAAAATAAAGT-----TTTTTTCTTAACTA- P_pygmaeus300129 CAGTCTTTTCTT-CCTGCTTAAA--GCATTT------GGTGCATAAGTAT P_pygmaeus300181 AAGATAAATAAA-A-TA---AAATAAAG-------TTGTTTCTTAACTA- P_pygmaeus300202 TTGT----TACC-CCTGCTTAAA--GCACTAT----AGATGCATAACTAT P_pygmaeus300254 TTGT-TATTGTC-ATTGCTTAAA--GCATTG------GATACATAACTAT P_pygmaeus300333 AAGATAAATTAA-A-TA---AAATAAAG-------TTGTTTCTTAACTA- P_pygmaeus300349 TTAT-CATTTCC-C-TGCTTAAA--GCACTT------GATATATAACTAT P_pygmaeus300431 TTGTCCTTGCCC-CCTGCTCAAA--GCAATT-------GTTTCCCACAAT P_pygmaeus300432 TTGTGGTTGCCC-CCTGCTCAAAATAAAACT------GTTACCTTTCAAG P_pygmaeus300435 TTGT-TATTGTC-ATTGCTTAAA--GCATTG------GATACATAACTAT P_pygmaeus300599 TTGTCATTACCGGCCTGCTCAAATTAAAGTTGT------TTCTGAACTA- P_pygmaeus300728 TTGT-CGTTCCC-CCTGCTTAAA--GCACTT------GATGCATAACTAT P_pygmaeus300729 TTGT-CGTTCCC-CCTGCTCAAAATAAAGTT------GTTTCTTAACTAT R_norvegicus300080 TCAT-CATTCCC-CCTGCTTAAA--G---------------CATTACTAC R_norvegicus300150 AGGTTGTTCTCC-C-TGCTCAGAACGAT----TGATTGTTTCTTAACTA- R_norvegicus300810 TTGTTTTTACTC-CCTGCTCAAAAGGAAAGT------GTTACCTTCCAAG R_norvegicus300983 TTGG-CCTTCCC-CCTGCTTAAA--GCATTT------GATACCTTAGTAT R_norvegicus301034 TTGT-CGTTCCC-CCTGCTCAGAACAA--TT------GTTTCTTAACTAT R_norvegicus301035 TTGT-CGTTCCC-CCTGCTTAAA--GTATCT------GATACATTACTAT S_araneus300078 TTATCATTCCCC-CCTGCTTAAAATAAA------GTTATTTCTTAATTAA S_araneus300154 CTGTTGGTCCCC-C-TGCTTTAAATAAA------ATTGTTTCTTAAATG- S_araneus300972 TTGT-CGTTCCC-CCTGCTTAAA--GTAATT------GATGCAT-ACTAT S_araneus300973 TTGT-CGTTCCC-CCTGCTTAAAATAAAGTT------GTTTCTTAACTAT S_araneus300990 -TGTCACTCCCC-C-TGCTTAAAATAAA------GTTGTTTCTTAACTA- S_tridecemlineatus300133 TTGTCCTTTCCT-CCTGCTGAGA--GCAATT-------GCTTCCCACAAT S_tridecemlineatus300134 TTGTGT-TTTCC-CCTGCTCAAAATAAAACT------GTTACCTTCCAGG S_tridecemlineatus300271 TTGTTATTTCC--CCTGCTCAAAATAAAGTTATGGTTTCTTCTTACCTA- T_nigroviridis300071 TTGT-CGTTCCC-CCTGCAAAAA--GTGACA-----TGTTTCCTCGCTAT T_nigroviridis300072 TTGT-CGTTCCC-CCTGCAAAAA--CTAACC-----TGTTTCCA-GCTAT T_belangeri300085 TTGTCATTCCC--CCTGCTCAAAATAAATTTGC------TTCTTAACTA- T_belangeri300126 TTGTCCTCTCC--CCTGCCGAAA--GCAACT-------GTCTCCCACAAT T_belangeri300177 TTGT-CATTCCT-CCTGCTCAAAATAAACTT------GTTTCTTACCTAT T_belangeri300272 TTGTCATTCCC--CCTGCTCAAAATAAAGTTGT------TTCTTAACTA- T_belangeri300390 TTGT-CGTTCCC-CCTGCTTAAA--ACATCT------GATACGTGACTAT T_belangeri300391 TTGT-CGTTCCC-CCTGCTCAAAATAAATTT------GTTTCTTAACTAT X_tropicalis300061 TTGT-CGTTCCC-CCTGCAAAAA--ATAAAC-----TGCTTCCT-ACTAT X_tropicalis300117 TTGT-CGTTCCC-CCTGCAAAAA--ATAAAC-----TGCTTCCT-ACTAT C_familiaris300084 ------------CTCTGTCTAGCT--CAATTCTATAGTAAGAC-AGGGAC C_familiaris300085 ------------CCCTGTCCGCCA--TGGTGCT-TAGCA-GCC-AGGGAT C_familiaris300136 ------------ACCAGTCTGCTA--TACTACTGTAGCA--GATAGGGAT C_familiaris300144 -----------TACCTGTCTGCTA-TAC-CCCTGTAGCA-GCCAGGG-AC C_familiaris300423 ------------ACCTGTCTGCTA--TACCCCTGTAGCA--GCCAGGGAC C_familiaris300458 -------------AAAATCCTAGAGAAGAACACAGGCAACACCCTT---- C_familiaris300459 -----------TATCTGTCTGCTA-TTC-CCCTATAGCA-GCCAGGG-AC C_porcellus300001 -----------TACCTGTCTGCCA-TGC-CTGTGTAGCA-GCCAGGG-AC C_porcellus300507 ------------CTCTGTCTAACT--CAGTTCAATAGTAAGAC-AGGGAC C_porcellus300508 ------------CCCTGCCTGCCA--TGGTATCTTAGCA--GC-AGGGAT C_porcellus300555 -----------TACCTATCTGCCA-TGC-CTGTGTAGCA-GCCAGGGGAC C_porcellus300556 CTTTT---GTCTTTTCATTTTTATTGGTACCAGGGATCGAACTCACAACC C_porcellus300879 ------------CTCTGTCTAACA--TCATTCCATGGTGAGAC-AGAGAC C_porcellus300880 ------------ACCTGTCTGCCA--TGCCTGTGTAGCA--GCCAGGGAC C_porcellus300889 -----------TACCTGTCTGCCA-TGT-CTGTGTAGCA-GCCAGGG-AT C_porcellus300926 ----------GGGGATTTAGCTCAGCGGCATAAGCGCCTGCCT------- C_porcellus300927 TTTGG---CCTTTTTCTTTTTTGTGGGTACTGTGGATTGAACTCACAACT D_rerio300107 CCCTG------------TCTGTTT--GCATC-CTACAACTAAC-AGGGAC D_rerio300108 CCCTG------------TTTGTCT--ACTAC-TTA-GATCTGC-AGGGAC D_rerio300109 CCCTG------------TGTGTCT--GCATC-TCATGACTTGC-AGGGAC D_rerio300110 CCCTG------------TCTGTCT--ACTAC-TTA-GATCTGC-AGGGAC D_rerio300111 CCCTG------------TCTGTCT--GCATC-TCATGACTTGC-AGGGAC D_novemcinctus300052 -----------TCCCTGTCTGCTG-AAC-TCTCGTAGCA-GCCAGGG-AT D_novemcinctus300309 C----------------CCTGTCTGCTGAACTCTTGTAGCAGCCAAGGAT D_novemcinctus300322 ------------CCCTGTCTGCTG--AACTCTTGTAGCA--GCCAGACAG D_novemcinctus300470 ------------CCCTGACTGCTG--TGGTGCTGCCGCA-GCC-AGGGAC D_novemcinctus300487 C----------------CCTGTGTGCTGAACTCTTGTAGCGGCCAGGGAG D_novemcinctus300536 ------------GCCTGCCTGCTG--AACTCTTGTAGCAACCA-AGGA-C D_novemcinctus300557 C----------------CCTGTCTGCTGAACTCTTGTAGCAGCCAGGGAC D_melanogaster300232 GT---------TATGCGAATGTAA-GCATTGCGCCTATTCAGT--GTAAC D_melanogaster300235 GT---------GATGCGAATGTAT-ATTATAAATCAATTCTGT--GTAAC D_melanogaster300237 GT---------TATGCGTATGTAA-GATA-ATCCCAGTACGAC--GTAAC E_telfairi300013 ------------CCCTGTCTGCTA--GTCTCTTGTAGCAGCCC-AGGGAC E_telfairi300017 ------------CCCTGTCTGCTA--GTTTCTTGTAGCAGCCC-AGGGAC E_telfairi300053 ------------TCCTGTCTGCTG--GTCTCTTGTAGCAGTCC-AGGGAT E_telfairi300065 ------------CCCTGTTTGC--------------------CCAGAGAC E_telfairi300068 ------------CCCTGTCCGCTA--GTTTCTTGTAGCAGCCC-AGGGAC E_telfairi300100 ------------CTCTGTCTAGCT--CAATTCTGTAGTAAGAC-AGGGAC E_telfairi300183 ------------CCCTGTCTGCTA--GTTTCTTGTAGCAGCCC-AGGGAA E_telfairi300262 ------------CTCTGTCTGCTA--GTCTCTTGTAGCAGTTC-AGGGAC E_telfairi300278 ------------CCCTGTCTGCTA--GTTTCGTGTAGCAGCCC-AGGGAT E_telfairi300286 ------------CCCTGTCTGCTA--GTTTCTTGTAGCAACCC-AGGG-T E_telfairi300287 ------------CCCTGTCTGCTA--GTTTCTTGTAGCAACCC-AGGG-T E_telfairi300290 ------------CTCTGTCTGCTA--GTTTTTTGTAACAGCCC-AGGGAC E_telfairi300296 ------------CCCTGTCTGCTA--GTTTCTTGTAGCAGCCC-AGGGAT E_telfairi300376 ------------CCCTGTCTGTTA--GTTTCTTGTAGCAGTCC-AGGGAC E_telfairi300493 ------------CCCTGTCTGCGA--GTTTCTTGTAGCAGCCC-AGGGAC E_telfairi300503 ------------CCCTGTCTGCTA--GTTTATTGTTGCAGCCC-AGGGAC E_telfairi300567 ------------CCTTGTCTGCTA--GTTTCTTGTAGCAGCCC-AGGGAC E_telfairi300588 ------------CCCTGTCTGCTA--GCTTCTTGTAGCAGCCC-AGGGAT E_telfairi300628 ------------CCCTTTCTGCAA--GACTTGTGAATCA-GCCAAGGTAT E_telfairi300660 ------------CCCTGTCTGCTA--GTTCCTTGTAGCAGCCT-AGGGAT E_telfairi300682 ------------CCCTGTCTGCTA--GTTTCTTGTAGCAGCCC-AGGGAC E_telfairi300774 ------------CCCTGTCTGCTA--GTTTCTTGTAGCAGCCC-AGGGAC E_telfairi300781 ------------CCCTGTCTGCTA--GTTTCTTGTAGCAGCCC-AGGGTC E_telfairi300785 ------------CCCTGTCTGCTA--GTTTCTTGTAGCAGCCC-AGGGAC E_telfairi300798 ------------CCCTCTCTGCTA--GTCTCTTGTAGCAGCCC-AGGGAC E_caballus300140 ------------CTCTGTCTAGCT--GAATTCTATAGCAAGAC-AGGGAC E_caballus300141 ------------CCT-GTTGGCCA--CGGTGCTGTAGCA-GCC-AGGGAT E_caballus300347 ------------------CTGGCA--TAATTTCATAGTAAGAC------- E_caballus300348 ------------ACCTGTCTGCTA--TACTCTTGTAGCA--GCCAGGGAC E_europaeus300182 ------------CTCTGTCTAGCT--CAGTTCTATAGTGAGAC-AGGGAC E_europaeus300183 ------------CCC---TGGCCC--TGGTAATATACCCTGCC-AGGGAT E_europaeus300295 -----------CACCTATTGGCTT-TAT--TCTATACCA-GCCAAGG-GT E_europaeus300413 ------------ACCTGTCTGCTT--TATC-CTGTAGCA--G----AGAT E_europaeus300452 ------------CTCTGCATGGCA--CGATTTCATAGCCAGAC-AGAGAC E_europaeus300574 ------------CTCTGCATGGCA--TGATTTCATAGCCAGAC-AGAGAC E_europaeus300575 ------------ACCTGTCTGCTT--TATC-CTGTGGCA--GCCAGGGAC F_catus300104 ------------CCCTGTCTGCCC--TGGTGCT-TAGCA-GCC-AGGGAT G_gallus300112 CCCTA-------------CCTGCTTAGTTCC--CACAGCAGGT-AGGGAC G_aculeatus300135 ACCTG-------------TCA-GTCAGCATC-CCTAGACTGCC-AGGCAC G_aculeatus300136 ACCTG-------------TCA-GTCAGCATC-CCTAGACTGCC-AGGCAC G_aculeatus300137 ACCTG-------------TCA-GTCAGCATC-CCTAGACTGCC-AGGCAC G_aculeatus300138 ACCTG-------------TCA-GTCAGCATC-CCTAGACTGCC-AGGCAC H_sapiens300229 ------------CT----CTAACT--CCATTCCATACTAAGAC-AGAGAT H_sapiens300616 ------------ACCTGTCTGCTA--TTCTCCTGTAGCA--GCCAGGGAC H_sapiens300659 -----------TACCCATCTGCTA-TTC-T---GTAGCA-GCCAGGG-AT L_africana300457 ----------AACTGTCTCTAGCT--CAGTCACATAGTAAGATTGGAGAT L_africana300458 ------------CCCTGTCTGCTA--AGCCCTTGTAGCAGCCC-AGGGAC M_mulatta300131 ------------CTCTGTCTCACT--CAGTTCTATAGTAAGAC-ATGGAC M_mulatta300181 ------------CTCTGTCTAACT--CCATTCCACAGTAAG-----AGAT M_mulatta300251 ------------GTCTGTTTAACT--TCATTCCATAGTGAGAC-AAAGAT M_mulatta300385 -----------TACCTGTCTGCTA-TCT--GCTGTAGCA-GCCAGGG-AT M_mulatta300449 ------------CT----CTAACT--CCATTCCATACTAAGAC-AGAGAT M_mulatta300576 -----------TACCCATCTGCCA-TTC-T---GGAGCA-GCCAGGG-AT M_mulatta300608 ------------CTTTGTCTAACT--CCATTCTGTAGTGAGAC-AGAGAC M_mulatta300609 ------------ACCTGTCTGCTA--TATCCCTGTAGCA--GCCAGGGAC M_murinus300175 ------------T-CTGTCTAATT--CCATCCCATAGGAAGAC-AGATGT M_murinus300178 ------------TT----CTAACT--CCATTCCATAGTAAGAT-GCAGAT M_murinus300182 ------------TTCTGTGTTATT--CCATTCCACAGTAAGAC-AGAGAG M_murinus300234 ------------CCCTGTCTGCCC--TAGCGCTCTAGCA--GC-AGGGAT M_murinus300293 -----------TACCTCTCTGCT--TAT-TCCCTCAGCA-GCCAGGG-AT M_murinus300344 GGTTATTAATAACTCGGTCTAACT--TCATTCCTTAGCAAGAC-AGGGAC M_murinus300396 ------------CTCTGTCTAGCT--CAATTCTATAGTAAGAC-AGGGAC M_murinus300445 ------------CTCTGTCTAACT--TCATTTCATAGTAAGAC-AGGGAT M_murinus300492 ------------CTCTGTCTAACT--TCATTCCATAGTAAGAC-AGGGAC M_domestica300183 CCCT--------GTCTGTTTTGCTATATATGCCATAGCAG--CCAGGGAC M_domestica300184 CCCTG------------TCTAACT-GATAAC--ATAGTAAGAC-AGGGAC M_musculus300074 ------------CTCAGCCTAGCT--CTACCATAG--CAAGAC-AGAGAC M_musculus300555 ------------CTCTGCCTAGCT--CTACCATAG--GAA---------- M_musculus300643 -----------TACCTGTCTGCCA-TCT-GCCTGTAGCA-GCCAGGG-AT M_musculus300742 ------------CCCTGCCTGCTA--TGGTACCCAGGCA--GC-AGGGAT M_musculus300874 ------------CTCTGCCTAGCT--CTACCATAC--TAAGGC-AGAGAC M_musculus300875 ------------ACCTGTCTGCCA--TCTGCCTGTAGCA--GCCAGGGAC O_anatinus303697 CCCCGGCC--------GTCTACCTTGACGAC-CGCGGTGAGAC-GGGGAC O_cuniculus300025 ------------CTCTGTCTGGCT--CAAC-CTGTAGTAAGAC-AGGGAC O_cuniculus300217 ------------TCCTGTCTGCTC--TATCCCTGTAGCA--GCCAGGGAC O_cuniculus300272 ------------CCCAGTTCAAAA--GAAGACTATAGCA--GCTTGGGAC O_cuniculus300295 ------------CTAACTATGCTA--TATCCTTGTAACA--GCCAGGGAT O_cuniculus300300 ------------ATCTGTCTGCTC--TACCCGTGTAGCA-GCCTTATTAC O_cuniculus300334 ------------ACCTGTCTGTTC--CACCTCTGTAGCA--GCCAAAGAT O_cuniculus300371 -----------TACCTGTCTGCTA-TACACCCTGTAGCA-GCCAGGG-AT O_cuniculus300372 TTTTT---TTAAAGATTTATTTATTTAT-TTGAAAGTCAGATTTACACAC O_cuniculus300446 ----------------GTCTACCA--AATCCCTTTAAAA--ACCAGGGAC O_cuniculus300502 --------------CTGTCTACCTA-CCATTTCATAGTAGGAC-AGAC-- O_cuniculus300503 -------------NNNNNNNNNNNNNNNNNNN------------------ O_latipes300064 CCCTG-------------TCT-GTCTAGATC-CCC-GACAGTT-AGGGAC O_latipes300065 CTCTG-------------GCA-----CGATC-TTGTGACTGCC-AGAGTC O_garnettii300144 ------------CT----CTGTCT--A-----------AAGGC-AGAGAT O_garnettii300420 ------------TT----CTAACT--CCATTCCATAGTAAGAC-AGAGAT O_garnettii300460 ------------CCCTGTCTGCCA--CTGTGCTCTAGCA--GC-AGGGAT O_garnettii300598 -----------TACCTGTCTGCTC-TAC-CCCTGTAGCA-GACAGGG-AT O_garnettii300682 ------------CTCTGTCTAACT--CCATTCCATAGTAAGAC-AGAGAC P_troglodytes300109 ------------CT----CTAACT--CCATTCCATACTAAGAC-AGAGAT P_troglodytes300165 ------------GTCTGTTTAACT--TCATTCCATAGTGAGAC-AGAGAC P_troglodytes300170 ------------CTCTGTCTAACT--C-ATTCTGCAGTAAGAC-AGAGAT P_troglodytes300344 -----------TACCTGTCTGCTA-TCT--GCTGTAGCA-GCCAGGG-AT P_troglodytes300348 -----------TACCTGTCTGCTA-TTC-TCCTGTAGCA-ACCAGGG-AT P_troglodytes300349 ------------CTCTGTCTCACT--CGGTTCTATAGTAAGAC-ATGGAC P_troglodytes300350 ------------CCCTGTCTGCCG--TGGTGCTGTAGCA--GC-AGGGAT P_troglodytes300370 ------------CT----CTAACT--CGATTCCATAATAAGAC-AGAGAC P_troglodytes300519 -----------TACCCATCTGCTA-TTC----TGTAGCA-GCCAGGG-AT P_troglodytes300632 ------------CTCT----AACT--CCATTCCGTAGTAAGAC-AGAGAC P_troglodytes300633 ------------ACCTGTCTGCTA--TTCTCCTGTAGCA--GCCAGGGAC P_pygmaeus300093 -----------TACCTGTCTGCTA-TCT--GCTGTAGCA-GCCAGGG-AT P_pygmaeus300129 ------------CT----CTAACT--CCATTCCATAATAAGAC-AGAGAT P_pygmaeus300181 -----------TACCTGTCTGCTA-TTC-TCCTGTAGCA-ACCAGGG-AT P_pygmaeus300202 ------------GTCTGTTTAACT--TTATTCCATAGTGAGAC-AGAGAT P_pygmaeus300254 ------------CT----CTAACT--CCATTCCATACTAAGAC-AGAGAT P_pygmaeus300333 -----------TACCTGTCTGCTA-TTC-TCCTGTAGCA-ACCAGGG-AT P_pygmaeus300349 ------------CTCTGTCTAACT--C-ATTCCACAGTAAGAC-AGAGAT P_pygmaeus300431 ------------CTCTGTCTCACT--CAGTTCTATAGTAAGAC-ATGGAC P_pygmaeus300432 ------------CCCTGTCTGCCA--TGGTGCTCTAGCA--GC-AGGGAT P_pygmaeus300435 ------------CT----CTAACT--CCATTCCATACTAAGAC-AGAGAT P_pygmaeus300599 -----------TACCCATCTGCTA-TTC-T---GTAGCA-GCCAGGG-AT P_pygmaeus300728 ------------CTCTGTCTAACT--CCATTCCGTAGTAAGAC-AGAGAC P_pygmaeus300729 ------------ACCTGTCTGCTA--GTCTCCTGTAGCA--GCCAGGGAC R_norvegicus300080 ------------CTCTGCCTAGCT--CTACCATAG--TAAGGC-AGAGAT R_norvegicus300150 -----------GACTTGTCTGCTA-TCT-ACCTGTAGTG-GCCAGGG-AA R_norvegicus300810 ------------CCCTGCCTGCTG--TGGTACCCAGGCA--GC-AGGGAT R_norvegicus300983 ------------CGCTGCCTAGCT--CTACCATAGAGTAAGGC-AAACTC R_norvegicus301034 ------------ACCTGTCTGCTG--TCTACCTGTAGCA--GCCAGGGAC R_norvegicus301035 ------------CTCTGCCTAGCT--CTACCATAG--TAAGGC-AGAGAC S_araneus300078 CTA--------CACCTGTCTGATT-GAC-ACCTGTTGCA-GTCAGGA-AC S_araneus300154 -----------TACCTGTCTGCTT-GAC-TCCTGTTGCA-GCCAGGG-AT S_araneus300972 ------------CTCTGTCTAGCA--CGATTCTGTAGTAAGAC-AGAGAC S_araneus300973 ------------ACCTGTCTGCTT--AACACCTGTAGCA--GCCAGGGAC S_araneus300990 -----------CATCTCTCTGCTT-GAC-ACCTGTAGCA-GCTAGGA-AT S_tridecemlineatus300133 ------------CTCTGTCTTACT--CAATTCTGTAGTAAGAC-AGGGAC S_tridecemlineatus300134 ------------CCCTGCCTGCCT--TGGTGCCCTAGCA--GC-AGGGAT S_tridecemlineatus300271 -----------TACCTTTCTGTTA-TAC-CCAAATAGCA-GCTAGGG--C T_nigroviridis300071 ACCTG-------------TCAAGTCACCCTC-TCTTGACTGAC-AGGGAC T_nigroviridis300072 CCCTG-------------CTT-GTCTTCCTT-CGTAGACACCC-AGGGAC T_belangeri300085 -----------TACCTGTCTGCTA-TAC-TCAAGTAGCA-ACCAGGA-AC T_belangeri300126 ------------CTCTGTCTAACT--CAGTT-TATAGTAAGAC-AGGGAC T_belangeri300177 -----------ACTATACCTGTAAAAAAAAGGGGGGGGGGACAACAAAAG T_belangeri300272 -----------TACCTGTCTACTA-TAC-TCATATAGCA-GCCAGGG-AT T_belangeri300390 ------------CTCTGTCTAGCT--CCATTCAATAGTAAGAC-AGAGAC T_belangeri300391 ------------ACCTGTCTGCTA--TACTCAGGTAGCA--GCCAGGGAC X_tropicalis300061 CCCTG------------TCTGTTTTGACACTACCTCAGCCGAC-AGGGAC X_tropicalis300117 CCCTG------------TCTGTTTTGACACTACCTCAGCAGAC-AGGGAC C_familiaris300084 GCTTGGT---CTCAAACAT-- C_familiaris300085 GCAGGGT---CTCAGACAT-- C_familiaris300136 ACTTGAT---CTCATGCAC-- C_familiaris300144 GCTTGGT---CTCATACAT-- C_familiaris300423 GCTTGGT---CTCATACAT-- C_familiaris300458 --------------------- C_familiaris300459 GCTTGGC---CTCATACAT-- C_porcellus300001 GCTTGGT---CTCATACAT-- C_porcellus300507 GCTTGGT---CTCAAACAT-- C_porcellus300508 GCTTGGT---CTCATACAT-- C_porcellus300555 GCTTGGT---CTCATACAT-- C_porcellus300556 --------------------- C_porcellus300879 GCTTGGT---CTCAAACAT-- C_porcellus300880 GCTTGGT---CTCATACAT-- C_porcellus300889 GCTTGGT---CTCATACAT-- C_porcellus300926 --------------------- C_porcellus300927 --------------------- D_rerio300107 GCT-GGT---CTCAGACAA-- D_rerio300108 GCTTGGT---CTCAGACAT-- D_rerio300109 GCT-GGT---CTCAGACAT-- D_rerio300110 GCTTGGT---CTCAGACAT-- D_rerio300111 GCT-GGT---CTCAGACAC-- D_novemcinctus300052 GCTTAGT---CTCATACTT-- D_novemcinctus300309 GCTTGGT---CTCATAAAC-- D_novemcinctus300322 GCTTGGT---CTCATGCAC-- D_novemcinctus300470 GCA-GCT---CTCAGACAC-- D_novemcinctus300487 GCTTGGT---CTCATACAC-- D_novemcinctus300536 ACTTGGT---TTCATACAC-- D_novemcinctus300557 GCTTGGT---CTCATACAC-- D_melanogaster300232 ACGCAGCCTCGTTACAATA-- D_melanogaster300235 ACGCAGCCTCGTTACAACT-- D_melanogaster300237 ACGCAGCCACGTTACAGTT-- E_telfairi300013 TCTTGGT---CTCAAACAT-- E_telfairi300017 GCTTGAT---CTCATACAT-- E_telfairi300053 GCTTGCT---TTCATCCAT-- E_telfairi300065 GCTTGAG---CTCATACAT-- E_telfairi300068 ACTTGGT---CTCATACAT-- E_telfairi300100 GCTTGGT---TTCAGACAT-- E_telfairi300183 GCCTGGT---CTCATACAT-- E_telfairi300262 ATTTGGT---CTCATACAC-- E_telfairi300278 GCTTGGT---CTCATACAT-- E_telfairi300286 CTCATAC---ATTAAAAAAA- E_telfairi300287 CTCATAC---ATTAAAAAAA- E_telfairi300290 ACTTAGT---CTCACACAT-- E_telfairi300296 GCTTGGT---CTCATACAT-- E_telfairi300376 ACTTGGT---TTCATACAT-- E_telfairi300493 GCTTGGT---CTCATTCAT-- E_telfairi300503 ACTTGGT---CTCATACAT-- E_telfairi300567 CCTTGGT---CTCATACAT-- E_telfairi300588 GCTTGGT---CTCATACAT-- E_telfairi300628 TT--------CTCACAGAA-- E_telfairi300660 GCTTGGT---CTCATACAT-- E_telfairi300682 GCTTGGT---CTCATACAT-- E_telfairi300774 GCTTGGT---CTCATACAT-- E_telfairi300781 GCTTGGT---CTCATACAT-- E_telfairi300785 GCTTGGT---CTCATACAT-- E_telfairi300798 ACTTCAT---CTCATAGAG-- E_caballus300140 GCTTGGT---CTCAAACAT-- E_caballus300141 GCATGGT---CTCATACAT-- E_caballus300347 GCTTAGT---CTCAAACAT-- E_caballus300348 GCTTGGT---CTCATACAT-- E_europaeus300182 GCTTGGT---CTCAAACAT-- E_europaeus300183 GCACGGT---GTCACACAG-- E_europaeus300295 ACTTGGT---CTCATACAT-- E_europaeus300413 GCTTGGT---CTCATACAT-- E_europaeus300452 ACTTGGC---CTCATACAT-- E_europaeus300574 GCTTGGC---CTCAGACAT-- E_europaeus300575 GCTTGGT---CTCATACAT-- F_catus300104 GCGTGGT---CTCAGACAT-- G_gallus300112 GCTGGGT---TTCATACAT-- G_aculeatus300135 GTACGGT---TTCAGACAA-- G_aculeatus300136 GTACGGT---TTCAGACAC-- G_aculeatus300137 GTACGGT---TTCAGACAC-- G_aculeatus300138 GTACGGT---TTCAGACAA-- H_sapiens300229 GTTGCAT---CTCAAACAT-- H_sapiens300616 GCTTGGT---CTCATACATGT H_sapiens300659 GCTTGGT---CACATACAT-- L_africana300457 GCTTGGT---CTCAAACAT-- L_africana300458 GCTTGGT---CTCATACAT-- M_mulatta300131 GCTTGGT---CTCAAACAT-- M_mulatta300181 GCTTGGT---TTCATTTTT-- M_mulatta300251 GCTTGGT---TTCAATCAT-- M_mulatta300385 ACTTGGT---TTCATACAT-- M_mulatta300449 GTTGCAT---CTCAAACAT-- M_mulatta300576 GCTTGGT---TACATACAT-- M_mulatta300608 GCTTGGC---TTCAAACAT-- M_mulatta300609 GCTTGGT---CTCATACAT-- M_murinus300175 GCTCGCT---CTTAAATAT-- M_murinus300178 ACTTGGT---CTCAAACAT-- M_murinus300182 GCTTGGT---CTCATTTTT-- M_murinus300234 GCTTGGT---CTCATACAT-- M_murinus300293 GCTTGGT---CTCATACAT-- M_murinus300344 GCTTGGT---CTCAAACAT-- M_murinus300396 GCTTGGT---CTCAAACAT-- M_murinus300445 TTTTAGT---CTCAAGCAT-- M_murinus300492 GCTTGGT---CTCAAACAT-- M_domestica300183 GCTTGAT---CTCAAACAT-- M_domestica300184 GCTTGGT---CTCAAACAA-- M_musculus300074 ACTTGGC---TTCAAACAT-- M_musculus300555 ---TGGT---TTCTAACAT-- M_musculus300643 GCTCGGT---CTCAAACAT-- M_musculus300742 GCTTGGT---TTCATACAG-- M_musculus300874 GCTTGGT---TTCAAACAT-- M_musculus300875 GCTTGGT---CTCAAACAT-- O_anatinus303697 GCTTGGT---TTCAAACAC-- O_cuniculus300025 GCTTGGT---CTCAAACAT-- O_cuniculus300217 ACTTGGT---CTCATACAA-- O_cuniculus300272 ACTTGGT---CTCATACAT-- O_cuniculus300295 ACTTGGT---CTCATACAT-- O_cuniculus300300 AGCAAGTGAACTCAA------ O_cuniculus300334 GCTTGGT---CTCATACAT-- O_cuniculus300371 GCTTGGT---CTCATATAT-- O_cuniculus300372 ACAC----------------- O_cuniculus300446 ACATGGT---CTCATAAAG-- O_cuniculus300502 ACTTGGT---CTGTTTTTC-- O_cuniculus300503 --------------------- O_latipes300064 GCAAGGT---CTCAGACAC-- O_latipes300065 GTATGGT---TTCAGACAC-- O_garnettii300144 TTTG-GT---CTCAAGCAT-- O_garnettii300420 GCTTAGT---CTTAAACAT-- O_garnettii300460 GCTTGGT---CTCATACAT-- O_garnettii300598 GCTTGGA---CTCAAATAT-- O_garnettii300682 GCTTGGT---CTCAAACAT-- P_troglodytes300109 GTTGCAT---CTCAAACAT-- P_troglodytes300165 GCTTGGT---TTCAAACAT-- P_troglodytes300170 GCTTGGT---TTCATTTTT-- P_troglodytes300344 GCTTGGT---TTCATACAT-- P_troglodytes300348 GATTGGT---TTCATACAT-- P_troglodytes300349 GCTTGGT---CTCAAACAT-- P_troglodytes300350 GTTTGGT---CTCATACAT-- P_troglodytes300370 GCTTGGT---CTCAAACAT-- P_troglodytes300519 GCTTGGT---CACATACAT-- P_troglodytes300632 GCTTGGC---TTCAAACAT-- P_troglodytes300633 GCTTGGT---CTCATACAT-- P_pygmaeus300093 GCTTGGT---TTCATACAT-- P_pygmaeus300129 GCTTGGT---CTCAAACAT-- P_pygmaeus300181 GATTGGT---TTCATACAT-- P_pygmaeus300202 GCTTGGT---TTCAAACAT-- P_pygmaeus300254 GTTGCAT---CACAAACAT-- P_pygmaeus300333 GATTGGT---TTCATACAT-- P_pygmaeus300349 GCTTGGT---TTCATTTTT-- P_pygmaeus300431 GCTTGGT---CTCAAACAT-- P_pygmaeus300432 GTTTGGT---CTCATACAT-- P_pygmaeus300435 GTTGCAT---CACAAACAT-- P_pygmaeus300599 GCTTGGT---CACATACAT-- P_pygmaeus300728 GCTTGGC---TTCAAACAT-- P_pygmaeus300729 GCTTGGT---CTCATACAT-- R_norvegicus300080 GCTTGGC---TTCAAACAC-- R_norvegicus300150 GCTAGGT---CTCATACAT-- R_norvegicus300810 GCTTGGT---TTCATACAG-- R_norvegicus300983 GCTTGGT---TTCAAACAT-- R_norvegicus301034 GCTTGGT---CTCATACAT-- R_norvegicus301035 GCTTGGT---TTCAAACAT-- S_araneus300078 ACTTAGTAGTCTCATACAT-- S_araneus300154 ACTTGGT---CTCATAGAT-- S_araneus300972 GCTTGGC---CTCAAACAT-- S_araneus300973 GCTTGGT---CTCATACAT-- S_araneus300990 ACTTGGT---CTCAGTTAA-- S_tridecemlineatus300133 GCTTGGT---CTCAAACAT-- S_tridecemlineatus300134 GCTTGGT---CGCATACAT-- S_tridecemlineatus300271 ACTTGGT---CACATACAT-- T_nigroviridis300071 GTAAGGT---TTCAGACAA-- T_nigroviridis300072 GCAAGGT---CTCAAACAG-- T_belangeri300085 ACTTGGT---CTCATACAC-- T_belangeri300126 GCTTGGT---CTCAAACAC-- T_belangeri300177 --------------------- T_belangeri300272 GCTTGGT---CTCATACAC-- T_belangeri300390 GCTTGGT---CTCAAACAT-- T_belangeri300391 GCTTGGT---CTCATACAT-- X_tropicalis300061 GCTTGGT---CTCAAACAT-- X_tropicalis300117 GCTTGGT---CTCAAACAG--

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved