snOPY snoRNA Orthological Gene Database

Family: SNORD63

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300333 GTGCAATGATGGATTTTATTTATCAACACATCATTCTGATA-AGATAGGTGTGTGGAAAA C_porcellus300896 GTGCAGTGATGCATTTTATT---CAACACATCATTCTCAAA-GTACAGAAGTGTGGAAAA D_rerio300208 -----------CATTCTGAT---CAACACATCATTCTGAAG-GATTTTAAATGTTTAGAA E_telfairi300783 GTGCAGTGATGCAG---ATACATCAACACATCATTCTGAAA-AGACAGATGTGTAGAAAA E_caballus300313 GTGCGATGATGCATTTTACTCATCAACACATCATTCTGAAA-GGACAGGTGTGTGGAAAA E_europaeus300671 GTGCAGTGATGCATTTTATTCATCAACACATCATTCTGAAA-ATACAGATGTGTGGAAAA F_catus300322 GTGCAATGATGCATATTATTTATCAACACATCATTCTGATA-AGATAGGTGTGTGGAAAA H_sapiens300550 GTGCAATGATGTATTTTATT---CAACACATCATTCTGAAA-----GAACGTGTGGAAAA M_mulatta300723 GTGCGATGATGTATTTTATT---CAACACATCATTCTGAAA---GAACATATGTGGAAAA M_murinus300491 GTGCAATGATGCATTTTATTCATCAACACATCATTCTGAAA-GCACAGATGTGTAGAATA M_musculus300732 GTGCGATGATGCATTTTATT---CAACACATCATTCTGAAA---ATAGATGTGTAGAGAA O_anatinus302246 GTGCCGTGATGGATTT-AACGATCGACACATCATTCCGAAA-CGAGCG--GTGTGGACAG O_anatinus302469 GTGACTTGGAGTATTT-ATTT-CCAACACGTCATTTTGAAA-CCCAAG--GTG-TGGTTT O_cuniculus300437 GTGCAGTGATGCATTTTATTTAACAACACATCATTCTGAAC-TCACAGATGTGTGGAGAA P_troglodytes300710 GTGCAATGATGTATTTTATT---CAACACATCATTCTGAAA-----GAACGTGTGGAAAA P_pygmaeus300760 GTGCAATGATGTATTTTATT---CAACACATCATTCTGAAA-----GAACGTGTGGAAAA R_norvegicus300985 GTGCAGTGATGTATTT-GT----CAACACATCATTCTGAAG-GAAAGT--GTGGTGACGT R_norvegicus300986 GTGCAATGATGCATTTTATTAATCAACACATCATTCTGAAA---GCAGATGTGTAGAGAA S_araneus301053 GTGCAGTGATGCATTACATTAATCAACACATCATTCTGAAA-AGACAGATGTGTAGAAAA T_belangeri300304 GTGCAATGATGCATTTTATTCATCAACACATCATTCTGAAAAGCACAGATGTGTAGAAGA * * **** ***** * ** C_familiaris300333 CTAAT-GACTGAGCACA C_porcellus300896 CTTAATGACTGAGCACA D_rerio300208 TTAGT-GTTTGA----- E_telfairi300783 TAAAT-GACTGAGCACA E_caballus300313 CTAAT-GACTGAGCACA E_europaeus300671 TTAGT--ACTGAGCACA F_catus300322 CTAAT-GACTGAGCACA H_sapiens300550 CTAAT-GACTGAGCACA M_mulatta300723 ATAAT-GACTGAGCACA M_murinus300491 CTAAA-GACTGAGCACA M_musculus300732 ATGAT-AACTGAGCACA O_anatinus302246 CTAAT-GACTGAGCACA O_anatinus302469 TTTTA-AACTGAGCACA O_cuniculus300437 CTAAT-GACTGAGCACA P_troglodytes300710 CTAAT-GACTGAGCACA P_pygmaeus300760 CTAAT-GACTGAGCACA R_norvegicus300985 CTTAT-TACTGAGCACA R_norvegicus300986 GTAAT-AACTGAGCACA S_araneus301053 CTAAT-GACTGAGCATG T_belangeri300304 CTTAATGACTGAGCACA ***

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved