snOPY snoRNA Orthological Gene Database

Family: SNORD63

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300333 GTGCAATGATGGATTTTATTTATCAACACATCATTCTGATAAG-ATAGGTGTG-TGGAAA C_porcellus300896 GTGCAGTGATGCATTTTATT---CAACACATCATTCTCAAAGT-ACAGAAGTGTGGAAAA D_rerio300208 -----------CATTCTG---ATCAACACATCATTCTGAAGGA-TTTTAAATG-TTTAGA E_telfairi300783 GTGCAGTGATGCAG---ATACATCAACACATCATTCTGAAAAG-ACAGATGTG-TAGAAA E_caballus300313 GTGCGATGATGCATTTTACTCATCAACACATCATTCTGAAAGG-ACAGGTGTG-TGGAAA E_europaeus300671 GTGCAGTGATGCATTTTATTCATCAACACATCATTCTGAAAAT-ACAGATGTG-TGGAAA F_catus300322 GTGCAATGATGCATATTATTTATCAACACATCATTCTGATAAG-ATAGGTGTG-TGGAAA G_gorilla300773 GTGCAATGATGTATTTTATT---CAACACATCATTCTGAAA---GAACGTGTG-G--AAA G_gorilla300774 GTGCTGTGATGTATTT-GT----CAACACATCACTCTGAAGAA-AAGTATGTG-GTGACT H_sapiens300550 GTGCAATGATGTATTTTATT---CAACACATCATTCTGAAA---GAACGTGTG-G--AAA M_mulatta300723 GTGCGATGATGTATTTTATTCA---ACACATCATTCTGAAAGA-ACA--TATG-TGGAAA M_murinus300491 GTGCAATGATGCATTTTATTCATCAACACATCATTCTGAAAGC-ACAGATGTG-TAGAAT M_musculus300732 GTGCGATGATGCATTTTATT---CAACACATCATTCTGAAA---ATAGATGTG-TAGAGA M_lucifugus300743 GTGCAATGATGCATTCTATTCATCAACACATCATTCTGAAAAG-ACAGGTGTG-TAGAAA M_lucifugus300998 -----GTGCTGTATT--GT----CAACACATCATTCTGAAGAA-AAGTATGTG-GTGACG O_anatinus302246 GTGCCGTGATGGATTTAACGA-TCGACACATCATTCCGAAACG-AGCGGTGTG-G--ACA O_anatinus302469 GTGACTTGGAGTATTT-ATTT-CCAACACGTCATTTTGAAACC-CAAGGTGTG-GT---T O_cuniculus300437 GTGCAGTGATGCATTTTATTTAACAACACATCATTCTGAACTC-ACAGATGTG-TGGAGA P_troglodytes300710 GTGCAATGATGTATTTTATT---CAACACATCATTCTGAAA---GAACGTGTG-G--AAA P_pygmaeus300760 GTGCAATGATGTATTTTATT---CAACACATCATTCTGAAA---GAACGTGTG-G--AAA R_norvegicus300985 GTGCAGTGATGTATTT-GT----CAACACATCATTCTGAAGGA-AAG--TGTG-GTGACG R_norvegicus300986 GTGCAATGATGCATTTTATTAATCAACACATCATTCTGAAA---GCAGATGTG-TAGAGA S_araneus301053 GTGCAGTGATGCATTACATTAATCAACACATCATTCTGAAAAG-ACAGATGTG-TAGAAA T_belangeri300304 GTGCAATGATGCATTTTATTCATCAACACATCATTCTGAAAAGCACAGATGTGTAGAAGA * **** *** * * ** C_familiaris300333 ACTAATGACTGAGCACA C_porcellus300896 CTTAATGACTGAGCACA D_rerio300208 ATTAGTGTTTGA----- E_telfairi300783 ATAAATGACTGAGCACA E_caballus300313 ACTAATGACTGAGCACA E_europaeus300671 ATTAGT-ACTGAGCACA F_catus300322 ACTAATGACTGAGCACA G_gorilla300773 ACTAATGACTGAGCACA G_gorilla300774 TCCTGTGACTGAGCATG H_sapiens300550 ACTAATGACTGAGCACA M_mulatta300723 AATAATGACTGAGCACA M_murinus300491 ACTAAAGACTGAGCACA M_musculus300732 AATGATAACTGAGCACA M_lucifugus300743 GTTAATGACTGAGCACG M_lucifugus300998 TCCTGTGACTGAGCACA O_anatinus302246 GCTAATGACTGAGCACA O_anatinus302469 TTTTTAAACTGAGCACA O_cuniculus300437 ACTAATGACTGAGCACA P_troglodytes300710 ACTAATGACTGAGCACA P_pygmaeus300760 ACTAATGACTGAGCACA R_norvegicus300985 TCTTATTACTGAGCACA R_norvegicus300986 AGTAATAACTGAGCACA S_araneus301053 ACTAATGACTGAGCATG T_belangeri300304 CTTAATGACTGAGCACA ***

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved