snOPY snoRNA Orthological Gene Database

Family: SNORD62

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300327 -TCTCCGTGATGTAATTCC-AATAGATCCTTCTGACCC--CCCCGTGGAC C_porcellus300871 -TCTTCATGATGGAATTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC C_porcellus300872 -TCTCCATGATGGAATTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC C_porcellus300963 -TCTCAGTGACCTGATGCC-AGTGGATCCTTCTGACCCCTCAGTGTGGAC D_novemcinctus300574 -TCTCAGTGATGTAATTCC-AGTAGATCCTTCTTACCTTCTACTGTGGAC E_telfairi300871 -TCTCAGTGATGTAATTCC-AATAGACCCTTCTGACCCTCCTCTGTGCAC E_telfairi300872 -TCTCGATGATGTAATTCC-AATAGATCCTTCTGACCCTCCGTTGTGGAC E_caballus300262 -TCTCAGTGATGCAATTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC E_caballus300263 -TCTCAGTGATGCAGTTCC-GATAGATCCTTCTGACCCTCCACTGTGGGC E_europaeus300078 ---TTCTTGATTAAGTTCC-AATAGAACCTTCTGACCTTCCACTGTGGAC E_europaeus300151 TTCTCAATGATGCAACTCC-AATAGATCCTTCTGAGCCTCCACTGGGGAC E_europaeus300221 -TCTCAATGATCCAATTTC-GATAGATTCTTCTGATCCTCCACTGTGGAC E_europaeus300268 -CCTCAATGATACAATTCT-AGTAGATCCTTCTGATCCTCCACTGTGGAC E_europaeus300416 -TCTCAGTGATGGAATTCCCAATAGATCCTTCTGACTCTCCACTGTGGAC E_europaeus300439 -TCTCAATGATGCAATTCC-AATATATCCTCCTGACCCTCCACTGTGGAC E_europaeus300461 -TCTCAATGATCCAATTTC-GATAGATTCTTCTGATCCTCCACTGTGGAC E_europaeus300553 -TCTCAATAATGCAATTCC-AATAGATCTTTCTGACCCTCCACTGTGGAC E_europaeus300554 -TCTCAATGATGCAATTCC-AATAGATCCTTCTGACCCTCCATTGTGGAC F_catus300235 -TCTCAATGATGCGATTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC H_sapiens300578 -TCTCAGTGATGTAATTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC H_sapiens300579 -TCTCAGTGATGTAATTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC L_africana300200 -TCTCAATGATGTAATTCC-AATAGATTCTTCTGACTCTCCACTGTGGGC M_mulatta300670 -TCTTAGTGATGTAATTCT-AATAGTTTCTTCCGACCTCCCACTGTGGAC M_mulatta300675 -TCTCAGTGATGTAATTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC M_mulatta300676 -TCTCAGTGATGTAATCCC-AATAGATCCTTCTGACCCTCCACTGTGGAC M_murinus300339 -TCTCAGTGATGTACTTCC-AGTAGATCCTTCTGACCT-CTACTGTGGAC M_murinus300417 -TCTCAGTGATGTACTTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC M_murinus300418 -TCTCAGTGATGTGCTTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC M_domestica300122 -TCTCTATGATGTA-TTCC-AATAGATCCTTCTGACCCTTCAATGTGTAC M_musculus300907 -TCTCAGTGATGTGTTTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC M_musculus300970 -TCTCAGTGATGTGTTTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC M_musculus300971 -TCTCAGTGATGTGTTTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC O_anatinus302321 -TCTCTATGATGTA-TTCC-AATAGATCCTTCTGACCCTCCAGTGTGCAT O_anatinus302672 -TCTCTATGATGTG-TTCC-AATAGATCCTTCTGACCCTCCACTGTGCAT O_garnettii300262 -TGTCAGTGAGGTATCTCC-AGTAGATCGTTCTGATCC-TCACTGTGGTC O_garnettii300384 -TCTCAGTGATGTGTTTCC-AATAGATCCTTCTAATCCTGCACTGTGGAC O_garnettii300529 -TGTCAGTGAGGTATCTCC-AGTAGATCGTTCTGATCC-TCACTGTGGTC O_garnettii300533 -TCTCAGTGATGTGTTTCC-AATAGATCCTTCTAATCCTGCACTGTGGAC O_garnettii300635 -TCTCAGTGATGTGGTTCC-AATAGATCCTTCTGACCCTGCACTGTGGAC P_troglodytes300575 -TCTCAGTGATGTAATTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC P_troglodytes300576 -TCTCAGTGATGTAATTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC P_troglodytes300581 -TCTTAGTGACATAATTCT-AATAGTTTCTTCCGACCTTCCACTGTGGAC R_norvegicus300938 -TCTCAGTGATGTGGTTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC R_norvegicus300939 -TCTCAGTGATGTGGTTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC S_tridecemlineatus300284 -CCTCAGTGATGTAATTCC-AATAGATCCTTCTGACCCTCCACTGTGGAC T_belangeri300296 -TCTCGGTGATGGAATTCC-AATAGATCCTTCTGACCCTGCACTGTGGAC * * * * * * * * * C_familiaris300327 TC-AAT-GCAGGGGGATGAAGAGGAAAGTGACT-GAGAGA--- C_porcellus300871 TC-AAAAGCAGGGAGATGACGAGGGCAGTGACT-GAGAGA--- C_porcellus300872 TC-AATAGCAGGGAGATGAGGAGGACAGTGACT-GAGAGA--- C_porcellus300963 TT-GGCAGCAGGGCGATGAGGAGGACAGGGAAT-GGGGAC--- D_novemcinctus300574 TC-AACAGCAGGGAGATGAAGAGGAAAATGACT-GAGAGA--- E_telfairi300871 TC-AGTCGCAGTGAGATGAAGAGGACTGTGATT-GAGAGA--- E_telfairi300872 TC--AGTAGCGGGAGATGAAGAGGACCATGGCT-GAGAGA--- E_caballus300262 TC--AAAGCAGGGAGATGAAGAGGAAAGTGACT-GAGAGA--- E_caballus300263 TC-AACAGCAGGGAGATGAAGAGGAAAGTGACT-GAGAGA--- E_europaeus300078 TC-AATAGCAGGAAAATGAAGAAGAAAGTGGAAAAAGAA---- E_europaeus300151 TC-AATAGCAGGGAGATGAAGAGGAAAAATAAAAAACAA---- E_europaeus300221 TC-AATAGCAGAGAGATGAAGAGGAAAGAAAAGAAAAGA---- E_europaeus300268 TC-AATAGCAGGGAGATGAAGAGGAAAGTAAAAGAAAAA---- E_europaeus300416 TC-AATAGCAGGGATATGAAGAGGAAGGTGACT-GAGAGA--- E_europaeus300439 TC-AATAGCAGGGAAACTAAGAGGGGGAAAAATGAGTTAGGGA E_europaeus300461 TC-AATAGCAGAGAGATGAAGAGGAAAGAAAAGAAAAGA---- E_europaeus300553 TC-AATAGCAGGGAGATGAAGAGGAAAGTGACTTGAGAGA--- E_europaeus300554 TC-AATAGCAGGGAGATGAAGAGGAAAGTGACT-GAGAGA--- F_catus300235 TC-AACG-CAGGGGG-TGAAGAGGAACGTGACT-GAGAGA--- H_sapiens300578 TC-AATAGCAGGGAGATGAAGAGGACAGTGACT-GAGAGA--- H_sapiens300579 TC-AATAGCAGGGAGATGAAGAGGACAGTGACT-GAGAGA--- L_africana300200 TC-AATAGCAGGGAGATGAAGAGGAGAGTGACT-GAGAGA--- M_mulatta300670 TC-AATAGCAGGGAAATGAAGAGGACAGTGATT-GCGCGA--- M_mulatta300675 TC-AATAGCAGGGAGATGAAGAGGACAGTGACT-GAGAGA--- M_mulatta300676 TC-AATAGCAGGGAGATGAAGAGGACAGTGACT-GAGAGA--- M_murinus300339 TC-AATAGCAGGGAGATGAAGAGGACAGTGCCG-GAGAGA--- M_murinus300417 TC-GATAGCAGGGAGATGAAGAGGACAGTGACT-GAGAGA--- M_murinus300418 TC-AATAGCAGGGAGATGAAGAGGACAGTGACT-GAGAGA--- M_domestica300122 TC-AGTAAAAGGGAAATGAAGAGACA-ATACCT-GAGAGA--- M_musculus300907 TC-AA-AACAGGGAGATGAAGAGGACAGTGACT-GAGAGA--- M_musculus300970 TC-AA-AGCAGGGAGATGAAGAGGACAGTGACT-GAGAGA--- M_musculus300971 TC-AA-AGCAGGGAGATGAAGAGGACAGTGACT-GAGAGA--- O_anatinus302321 TCCAAAGAAGGGGAAATGAAGAGATGTGTGACT-GAGAGA--- O_anatinus302672 TCCAAAGAAGGGCAAATGAAGAGATGTGTGACT-GAGAGA--- O_garnettii300262 TC-AGTAGGAGGGAGATGAAGACAACAGTGCCT-GAAAAA--- O_garnettii300384 TC-AATAGCAGGGAGATGACGAGGACAGTGACT-GAGAGA--- O_garnettii300529 TC-AGTAGGAGGGAGATGAAGACAACAGTGCCT-GAAAAA--- O_garnettii300533 TC-AATAGCAGGGAGATGACGAGGACAGTGACT-GAGAGA--- O_garnettii300635 TC-AATAGCAGGGAGATGACGAGGACAGTGACT-GAGAGA--- P_troglodytes300575 TC-AATAGCAGGGAGATGAAGAGGACAGTGACT-GAGAGA--- P_troglodytes300576 TC-AATAGCAGGGAGATGAAGAGGACAGTGACT-GAGAGA--- P_troglodytes300581 TC-AATAGCAGGGAGATGAAGAGGACAGTGATT-GCACGA--- R_norvegicus300938 TC-AA-AGCAGGGAGATGAAGAGGACAGTGACT-GAGAGA--- R_norvegicus300939 TC-AA-AGCAGGGAGATGAAGAGGACAGCGACT-GAGAGA--- S_tridecemlineatus300284 TC-AACGGCAGGGGGATGAAGAGAACAGTGACT-GAGAGG--- T_belangeri300296 TC-AATCGCAGGGGGGTGACGAGGACAGAGACT-GAGAGA--- * * * **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved