snOPY snoRNA Orthological Gene Database

Family: SNORD6

CLUSTAL W (1.83) multiple sequence alignment D_rerio300057 ------------CTTTGTAATGATGATTGGCATAAATGTTCAACTGCTCTTAAAAACCAT E_caballus300150 ------------TGTTGTTATGATGATGGGCAAAA-TGTTCAACTGCTCTGAATGGGC-T H_sapiens300748 -------------GATGTTATGATGATGGGCGAAA-TGTTCAACTGCTCTGAAGGGGC-T M_musculus300099 ------------TGATGTTGTGATGATGGGCAAAAATGTTCAACTGCTCTGAATGGGC-T T_nigroviridis300079 ATCTTTCTGGTTCATTCACGTGATGATTGGTGCGTTCACGGACCCATCCGTGACAGGCGC * ******* ** * * * * * D_rerio300057 GAA-AGAGGATTTGCCTTTCTGAACATGT------------ E_caballus300150 GAA-TGAAAATA-GCCTTTCTGAACATGCA----------- H_sapiens300748 GAA-TGAAAATG-GCCTTTCTGAACATC------------- M_musculus300099 GAA-TGAAAGTA-GCCTTTCTGAACATCT------------ T_nigroviridis300079 GACCTGCTCTTGTTACGCTCTGCGCCTCAGCCTTTCTGAAC ** * * * **** * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved