snOPY snoRNA Orthological Gene Database

Family: SNORD59

CLUSTAL 2.0.10 multiple sequence alignment A_thaliana300085 --CTCTTATGATGTCAA---------------AACTTTCGT-TCTCCT----GAGATTTC A_thaliana300086 --CTCTTATGATGTCAA---------------AACTTTCGT-TCTCCT----GAGATTTC C_familiaris300190 --ATTCTATGATGATTT-TATCAAAAT-----GACTTTTGT-TTTTCT----GAGTA-TG C_familiaris300442 --CCTCACTGATGAGTA-----GCTTCT----GACTTTCGT-TCTTCT----GAGTTTG- C_familiaris300443 -CCTTCAATGACGATTA-TATCAAAAT-----GACTTTCGT-TCTTCT----GAGTT-TG C_porcellus300328 --CCTCCCTGATGA--A-----GTTTCT----GACTTTTCGATCTTCT----GAGTTTG- D_novemcinctus300595 --CCTCATTGATGATTA-----ACTTCT----GACTTTCGT-TCTTCT----GAGTTTG- D_novemcinctus300617 --CCTCATTGATGAGTA-----GCTTCT----GACTTTCGT-TCTTCT----GAGTTTG- D_novemcinctus300618 --TTTCTATGATGATTT-CATCAAAAT-----GACTTTCGT-TCTTCT----GAGTT-TG D_melanogaster300005 -GTTTAAATGATGAATACCTTTATCTAT---TAACTTTCGT-TCTACTGA--GTGGTAAA E_telfairi300859 --CCTCATTGATGAGTA-----GCTTCT----GACTTTCGT-TCTTCT----GAGTTTG- E_caballus300246 --CCTCGCTGATGAGTA-----GCTTCT----GACTTTCGT-TCTTCT----GAGTTTG- E_caballus300247 -CCTTCTATGATGATTT-CATCAAAAT-----GACTTTCGT-TCTTCT----GAGTT-TG E_europaeus300572 -CCTTCACTGATGAATT----ATATTCT----GACTTTCGT-TCTTCT----GAGTTTG- E_europaeus300573 -CCTTCTATGATGATTC-TATCCAAAT-----GACTTTCGT-TCTTCT----GAGTT-TG F_catus300062 --ATTCTATGATGATTT-TATCAAAAT-----GACTTTTGT-TCTC-------AGTA-TG F_catus300306 --CCTCACTGATGAGTA-----GCTTCT----GACTTTCGT-TCTTCT----GAGTTTG- F_catus300307 -CCTTCTATGATGATTT-TATCAAAAT-----GACTTTCGT-TCTTCT----GAGTA-TG G_gallus300114 -CCTTCGCTGATGAGTA----ACCTTTT----GACTTTCGT-TCTACT----GAGCTTG- G_aculeatus300143 -TCTTCAGTGATGATT---AACA---------AACTTTCGT-TCTTCT----GAGTT-TA G_aculeatus300144 -TCTTCAGTGATGATT---AACA---------AACTTTCGT-TCTTCT----GAGTT-TA H_sapiens300690 --CCTCACTGATGAGTA-----CGTTCT----GACTTT-CGTTCTTCT----GAGTTTG- H_sapiens300691 -CCTTCTATGATGATTT-TATCAAAAT-----GACTTTCGT-TCTTCT----GAGTT-TG M_mulatta300302 --CCTCACTGATGAGTA-----GCTTCT----GGCTTTTG----TTCT----GAGATTA- M_mulatta300404 --ACTCACTGATGAGTA-----GCTTCT----AACTTTCAT-TCTTCT----GAGTTTG- M_mulatta300624 --CCTCACTGATGAGTA-----CATTCT--------TT-CATTCTTCT----GAGTTAG- M_mulatta300625 --CCTCTGTGATGATTT-TATCAAAAT-----GACTTTCGT-TCTTCT----GAGTT-TG M_murinus300525 --CCTCACTGATGAGTA-----GCTTCT----GACTTTCGT-TCTTCT----GAGTTTG- M_murinus300526 CCTTTCTATGATGATTT-TTTCAAAAT-----GACTTTCGT-TCTTCT----GAATT-TG M_domestica300193 -CCTTCACTGATGAGTA----GCTTTCT----GACTTTCGT-TCTTCT----GATTTTG- M_domestica300194 --CTTCCATGATGATTTCTAACTAGAT-----GACTTTCGT-TCTTCT----GAGTT-TG M_musculus300851 --ATTCTGTGATGACTT-TACC-AAAT-----GACTTTCGT-TCTTCT----GAGTT-TG O_anatinus302255 -CCTTCGCTGATGAGTG----ACTCTTT----GACTTTCGT-TCTTCT----GAGTCTG- O_cuniculus300452 -CCTTCACTGATGAGTA-----GCTTCT----GACTTTCGT-TCTTCT----GAGTTTGT O_cuniculus300453 CCTTTCTATGATGATTT-TATCAAAAT-----GACTTTCGT-TCTTCT----GAGTC-TG O_latipes300061 -TCTTCAGTGATGATTT--AATACAGT-----GACTTTCGT-TCTTCT----GAGAT-TA O_latipes300062 -TCTTCGGGGATGATT---TACACAGT-----GACTTTCGT-TCTTCT----GAGTC-TA P_troglodytes300147 --ACTCACTGATGAGTA-----GCTTCT----GACTTTCAT-TCTTCT----GAGTTTG- P_troglodytes300237 --CCTCATTGATTAGTA-----GCTTCT----GACTTTTG----TTCT----G--TTTG- P_troglodytes300646 -CCTTCTATGATGATTT-TATCAAAAT-----GACTTTCGT-TCTTCT----GAGTT-TG P_troglodytes300647 --CCTCACTGATGAGTA-----CGTTCT----GACTTT-CGTTCTTCT----GAGTTTG- P_pygmaeus300308 --ACTCACTGATGAGTA-----GCTTCT----GACTTTCAT-TCTTCT----GAGTTTG- P_pygmaeus300319 --CCTCACTGATTAGTA-----GCTTCT----GACTTTTG----TTCT----GAGTTTG- P_pygmaeus300648 --CCTCACTGATGAGTAA--CGTTTTCT----GACTTTTCGTTCTTCTT---GAGTTTGG P_pygmaeus300649 -CCTTCTATGATGATTT-TATCAAAAT-----GACTTTCGT-TCTTCT----GAGTT-TG R_norvegicus300881 --CTTCTGTGATGACTT-TACCCAAAT-----GACTTTCGT-TCTTCT----GAGTT-TG S_cerevisiae300071 ---TAAGATGATGATCAACTTTTTATATCAATAACTTTCGT-TCTACTGACTGTGATCAA S_araneus300205 -CCTACAAAGAGAATC-------ACTTT----GACAGTT-T-CATTTT----GAGTTTG- S_araneus301002 --CCTCGCTGATGAGTA-----GCTTCT----GACTTTCGT-TCTTCT----GAGTTTG- S_araneus301003 -CCTTCTGTGATGATTTTATCCAAAATT----GACTTTCGT-TCTTCT----GAGCT-TG T_nigroviridis300066 -TCTTCACTGAGGATCT----CAACTTT----GACTTTCGT-TCTTCT----GAGTTTC- T_nigroviridis300067 -TCTTCTGTGATGATC---AACACATT-----GACTTTCGT-TCTTCT----GAGTC-TA T_belangeri300200 --CCTTGCTGATGAGTA-----GCTTCT----GACTTTCGT-TCTTCT----GAGTTTG- T_belangeri300315 -CCTTCCATGATGATCT-TATCAAAAT-----GACTTTCGT-TCTTCT----GAGTT-TG X_tropicalis300079 -ACTTCCATGACGATTC---TCA---TT----GACTTTTGT-TCTTCT----GAGGT-TT X_tropicalis300080 -CCTTCTATGATGATTT---TTTCATTT----GACTTTCGT-TCTTCT----GAGTTATT X_tropicalis300081 -CCTGCAGTGATGAGTA----AAC---T----GACTTTCGT-TCTACT----GAATTTG- ** * * A_thaliana300085 AATATGCTGAAAAAAATTGGAGACCTGAACTGAAAGAG A_thaliana300086 AATATGCTGAAAAAAATTGGAGACCTGAACTGAAAGAG C_familiaris300190 C---TGAAGCCACA-TATTAAGTATTGAGAAGG----- C_familiaris300442 C---TGAAGCCAGA-TGCCATTC-CTGAGAAGG----- C_familiaris300443 C---TGAAGCTACA-TTTCAGGTACTGAGAAGG----- C_porcellus300328 C---TGAAGCCAGA-TGCCATGC-CAGAGAAGA----- D_novemcinctus300595 C---TGAAGCCAGA-TCCAATTC-CTGAGAAGG----- D_novemcinctus300617 C---TGAAGCCAGA-TGCCATTC-CTGAGATGG----- D_novemcinctus300618 C---TGAAGCCACA-TGT-AGGTTCTGAGAAGG----- D_melanogaster300005 -------TGCGGATATATTTT--TCTGATTCA------ E_telfairi300859 C---TGAAGCCAGA-TGCCATTT-CTGAGAAGG----- E_caballus300246 C---TGAAGCCAGA-TGCCATTC-CTGAGAAGG----- E_caballus300247 C---TGAAGCCACG-TTT-AGGTACTGAGAAGG----- E_europaeus300572 C---TGAAGCCAGA-TGTGATTC--TGAGGAGG----- E_europaeus300573 C---TGAAGCCATA-TTT-AGGCTCTGAGAAGG----- F_catus300062 T---TGAAGCCACA-TTTTAGGTACTGAGAAGG----- F_catus300306 C---TGAAGCCAGA-TGCCATTC-CTGAGAAGG----- F_catus300307 C---TGAAGCCACA-T-TTAGGTACTGAGAAGG----- G_gallus300114 C---TGAAGCAACG-TTCATTAC-CTGAGGAGG----- G_aculeatus300143 C---TGAAGCCAAC-ATTTCTATCCTGAGAAGA----- G_aculeatus300144 C---TGAAGCCAAT-ATTTCTGTCCTGAGAAGA----- H_sapiens300690 C---TGAAGCCAGA-TGCAATTT-CTGAGAAGG----- H_sapiens300691 C---TGAAGCCACA-TTT-AGGTACTGAGAAGG----- M_mulatta300302 C---TAAAGCTAGA-TGCCATTC-CAGATAAGA----- M_mulatta300404 C---TGAACCCAGA-TGCCATTC-CTGGGAAGG----- M_mulatta300624 C---TGAAGCCATA-TGCAATTT-CTGAGAAGG----- M_mulatta300625 C---TGAAGCCGCA-TTT-AGGTACTGAGAAGG----- M_murinus300525 C---TGAAGCCAGA-TGCCATTT-CTGAGAAGG----- M_murinus300526 C---TGAAGCCACA-TTT-AGGTACTGAGAAGG----- M_domestica300193 C---TGAAGCCAGA-TGCCACTT-CTGAGAAGG----- M_domestica300194 C---TGAAGCCATG-CTT-AGAATCTGAGCAAG----- M_musculus300851 C---TGAAGCCACA-CTC-AGGTGCTGAGAGGG----- O_anatinus302255 C---TGAAGCCATT-TGTCTATT-CTGAGAAGG----- O_cuniculus300452 CGAGTGAAGCCAGA-TGCTGTTC-CTGAGATGG----- O_cuniculus300453 C---TGAAGCCATG-TTT-CGATACTGAGAAGG----- O_latipes300061 C---TGAAGCCAAC-ATTTCTGTCCTGAGAAGA----- O_latipes300062 C---TGAAGCCAGC-CTTTCTGTTCTGAGAAGA----- P_troglodytes300147 C---TGAACCCAGA-TGCCATTC-CTGGGAAGG----- P_troglodytes300237 C---TGAAGCTAGA-TGCCATTC-CAGATAAGA----- P_troglodytes300646 C---TGAAGCCACA-TTT-AGGTACTGAGAAGG----- P_troglodytes300647 C---TGAAGCCAGA-TGCAATTT-CTGAGAAGG----- P_pygmaeus300308 C---TGAACCCAGA-TGCCATTC-CTGGGAAGG----- P_pygmaeus300319 C---TGAAGCTAGA-TGCCATTC-CAGATAAGA----- P_pygmaeus300648 C---TGAAGCCAGA-TGCAATTTTCTGAGAAAG----- P_pygmaeus300649 C---TGAAGCCACA-TTT-AGGTACTGAGAAGG----- R_norvegicus300881 C---TGAAGCCACA-CTC-AGGTGCTGAGAGAG----- S_cerevisiae300071 ACGATCTTGTAGAGAACTTTTACTCTGAAT-------- S_araneus300205 ---CTGAAGTAAAA--TTTACTTACTTGGAAGA----- S_araneus301002 C---TGAAGCCAGA-TGCCATTC--TGAGAAGG----- S_araneus301003 C---TGAAGCCATA-ATAGAGAAACTGAGAAGG----- T_nigroviridis300066 ---ATGAAGCTGATGTTTTTCACACTGAGAAGA----- T_nigroviridis300067 C---TGAAGCCA-C-CTCGTTGTCCTGAGATGA----- T_belangeri300200 C---TGAAGCCAGA-TGACATTT-CTGAGAAGG----- T_belangeri300315 C---TGAAGCCATA-TTT-ATGTACTGAGAAGG----- X_tropicalis300079 C---TGAAGCAACT-TGATTT--TCTGAGAAGT----- X_tropicalis300080 C---TGAAGCGATT-TTATATAGTCTGAAAAGG----- X_tropicalis300081 C---TGAAGACATA-TTT-TTAT-CTGAAAAGG-----

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved