snOPY snoRNA Orthological Gene Database

Family: SNORD58

CLUSTAL W (1.83) multiple sequence alignment C_elegans300009 CAAGAGCTCAGACTAAGGCGTACTATTTTTCTTTTCAGCAGACCGAGGCC C_familiaris300364 -------CCGCGATGATGGC---------ATTTCTTAGGACACCTTTGGA C_familiaris300365 -------CTGCGGTGATG-C---------ATCTCTTAGGACACCTTTGGA C_familiaris300366 -------TTGCTGTGATGACC----------ATCTTAGGACACCTTTGGA C_porcellus300623 -------TTGCTGTGATAACT----------ATCTTAGGACACCTTTGGA C_porcellus300624 -------CTGCGGTGATG-C---------CTTTCTTAGGACACCTTTGGA C_porcellus300625 -------CTGCGGTGATGGC---------GTTTCTTAGGACACCTTTGGA D_rerio300093 -------GTACAGTGATGAC---------A-TTCTTAGGACACCTTTGGA D_rerio300094 -------GTACAGTGATGAC---------A-TTCTTAGGACACCTTTGGA D_rerio300186 -------GTACGATGATGAC---------A-ATCTTAGGACACCTTTGGA D_novemcinctus300499 -------TTGCTATGATGACT----------ATCTTAGGACACCTTTGGA D_novemcinctus300500 -------CTGCAGTGATG-A---------CTTTCTTAGGACACCTTTGG- D_novemcinctus300501 -------CTGCAGTGATGGA---------ATTTCTT-GGACACCTTTGGA D_melanogaster300080 ------TTTTCAATGATGATTTTCGAGTTTTACCTTGGGACACCTATGAA D_melanogaster300081 ------GTTTTTGTGATGACATAGCTATTTTACCTTGGGACACCTATGAA E_telfairi300757 -------TTGCAGTGATGAC----------CATCTTAGGACACCTTTGGA E_telfairi300758 -------CTGCTGTGATG-A---------CTTTCTTAGGACACCTTTGGA E_telfairi300759 -------CTGCGATGATGGC---------GCTTCTTAGGACACCTTTGGA E_caballus300026 -------CTGCGATGATGGC---------ATTTCTTAGGACACCTTTGGA E_caballus300279 -------TTGCTGTGATGACT----------AACTTAGGACACCTTTGGA E_caballus300280 -------TTGCTGTGATGACA----------ATCTTAGGACACCTTTGGA E_caballus300281 -------CTGCCGTGATG-C---------TT-TCTTAGGACACCTTTGGA E_europaeus300087 -------CTGCAGTGATG-C---------TTCTCTTAGGATACCTTTGGA E_europaeus300517 -------TTGCTGTGATGACT----------AACTTAGGACACCTTTGGA E_europaeus300580 -------CTGCGGTGATG-C---------TTCTCTTAGGACACCTTTGGA F_catus300280 -------CTGCAGTGATG-C---------GTTTCTTAGGACACCTTTGGA F_catus300281 -------CTGCGATGATGGC---------ATTTCTTAGGACACCTTTGGA G_gallus300115 -------TTACTATGATGACTT---------ATCTTAGGACACCTTTGGA G_gallus300116 -------TGGTGGTGATGAC----------TATCTTAGGACACCTTTGGA G_gallus300118 -------TTGCTGTGATGACT----------TTCTTAGGACACCTTTGGA G_gallus300119 -------TGGCGGTGATGAC----------TATCTTAGGACACCTTTGGA G_gallus300120 -------TTGCTGTGATGACTT---------ATCTTAGGACACCTTTGGA G_aculeatus300145 -------CAGCAGTGATG-A---------GTAT-TTAGGACACCTTTG-- H_sapiens300240 -------TTGCTGTGATGACT----------ATCTTAGGACACCTTTGGA H_sapiens300241 -------CTGCGATGATGGC---------ATTTCTTAGGACACCTTTGGA H_sapiens300468 -------CTGCAGTGATG-A---------CTTTCTTAGGACACCTTTGGA L_africana300337 -------TTGCTGTGATGACT----------ATCTTAGGACACCTTTGGA L_africana300447 -------TTGCAGTGATGAC----------AATCTTAGGACACCTTTGGA M_mulatta300683 -------TTGCTGTGATGACT----------ATCTTAGGACACCTTTGGA M_mulatta300684 -------CTGCGGTGATG-A---------CTTTCTTAGGACACCTTTGGA M_mulatta300685 -------CTGCGATGATGGC---------ATTTCTTAGGACACCTTTGGA M_murinus300032 -------TTGCTATGATGACT----------ATCTTAGGACACCTTTGGA M_murinus300033 -------CTGCGATGATGGT---------ATTTCTTAGGACACCTTTGGA M_murinus300307 -------CTGTGATGATGGC---------ATTTCTTAGGACACCTTCGGA M_murinus300563 -------TTGTTAGGATGACA----------GTCTGAGGACACTTTTGGA M_domestica300053 -------CTGCAGTGATGAC---------GATTCTTAGGACACCTTTGGA M_domestica300140 -------TTGCTATGATGACA----------ATCTTAGGACACCTTTGGA M_domestica300141 -------TGGCAGTGATGAC----------TCTCTTAGGACACCTTTGGA M_domestica300142 -------TTGCTATGATGACA----------ATCTTAGGACACCTTTGGA M_domestica300143 -------CTGCAGTGATGAC---------TTTTCTTAGGACACCTTTGGA M_musculus300308 -------CTGCGATGATGTCATTC-----ATATCTTAGGACACCTTTGGA M_musculus300733 -------CTGCGATGATGTC---------ATATCTTAGGACACCTTTGGA M_musculus300734 -------CTGCAGTGATG-A---------CTATCTTAGGACACCTTTGGA M_musculus300735 -------TTGCTGTGATGACTA----------TCTTAGGACACCTTTGGA M_lucifugus300973 -------TTGCTGTGATGACT----------AACTTAGGACACCTTTGGA M_lucifugus300974 -------TTGCTGTGATGACA----------GTCTTAGGACACCTTTGGA M_lucifugus300975 -------CTGCAGTGATG-T---------CTTTCTTAGGACACCTTTGGA M_lucifugus300976 -------CTGCGATGATGGC---------ACCTCTTAGGACACCTTTGGA O_anatinus302248 -------CTGCGATGATG-A---------CCTTCTTAGGACACCTTTGGA O_anatinus302249 -------CTGCTATGATG-A---------CTTTCTTAGGACACCTTTGGA O_anatinus302250 -------TTGCTGTGATGACA----------TTCTTAGGACACCTTTGGA O_anatinus302251 -------TGGCGGTGATGAC----------ATTCTTAGGACACCTTTGGA O_anatinus302252 -------TTGCTGTGATGACA----------ATCTTAGGACACCTTTGGA O_cuniculus300177 -------TTGCTGTGATGGCT----------ATCTTAGGACACCTTTGGA O_cuniculus300178 -------CTGCAGTGATG-C---------TTTTCTTAGGACACCTTTGGA O_cuniculus300429 -------TTGCTGTGATGACAAA---------TCTTAGGACACCTTTGGA O_latipes300095 -------CTGCAGTGATGAC-----------CTCTTAGGACACCTTTGGA O_latipes300096 -------CTGCAGTGATG-A---------CCTTCTTAGGACACCTTTGG- O_garnettii300186 ---------------CTG-C---------CTTTCTTAGAACATCTTTGGA O_garnettii300196 -------TTGCAGTGATG-C---------CTCTCTTAGGACACCTTTGGA O_garnettii300299 -------CTGCAATGATGGC---------ATTTCTTAGGACACCTTTGGA O_garnettii300337 -------TTGCTATGATGACT----------ATCTTAGGACACCTTTGGA O_garnettii300636 -------CTGCAGTGATG-C---------CTTTCTTAGGACACCTTTGGA P_troglodytes300053 -------TTGCTGTGATGACT----------ATCTTAGGACACCTTTGGA P_troglodytes300054 -------CTGCGATGATGGC---------ATTTCTTAGGACACCTTTGGA P_troglodytes300555 -------CTGTGATGATGGC---------ATTTCTTAGGACAATTTTGGA P_troglodytes300681 -------CTGCAGTGATG-A---------CTTTCTTAGGTCACCTTTGGA P_pygmaeus300050 -------TTGCTGTGATGACT----------ATCTTAGGACACCTTTGGA P_pygmaeus300556 -------CTGTGATGATGGC---------ATTTCTTAGCACAATTTTGGA P_pygmaeus300681 -------CTGCAGTGATG-A---------CTTTCTTAGGACACCTTTGGA R_norvegicus300987 -------CTGCGATGATGTC---------ATTTCTTAGGACACCTTTGGA R_norvegicus300988 -------CTGCAGTGATG-A---------CTTTCTTAGGACACCTTTGGA R_norvegicus300989 -------TTGCTGTGATGACTA----------TCTTAGGACACCTTTGGA S_araneus300543 -------TTGCTGTGATGACT----------AACTTAGGACACCTTTGGA S_araneus301071 -------TTGCTGTGATGACC----------ATCTTAGGACACCTTTGGA S_tridecemlineatus300072 -------CTGCGATGATGGC---------AAATCTTAGGACACCTTTGGA S_tridecemlineatus300244 -------CTGCAGTGATG-C---------CTTTCTTAGGACACCTTTGGA S_tridecemlineatus300245 -------TTGCTGTGATGACTA----------TCTTAGGACACCTTTGGA T_nigroviridis300034 -------ATGCTGTGATGAC-----------TTCTTAGGACACCTTTGGA T_nigroviridis300035 -------CTGCGGTGATGAC----------TATCTTAGGACACCTTTGGA T_nigroviridis300036 -------TTGCACTGATGAC-----------CACTTAGGACACCTTTGGA T_belangeri300223 -------TTGCTGTGATGACT----------ATCTTAGGACACCTTTGGA T_belangeri300224 -------CTGCGATGATG-C---------ATTTCTTAGGACACCTTTGGA T_belangeri300240 -------CTGCAATAATGGC---------ACTTCTTAAGATACATTTGAA T_belangeri300281 -------CTGCAATAATGGC---------ACTTCTTAAGATACATTTGAA T_belangeri300322 -------CTGCAATGATG-C---------CATTCTTAGGACACCTTTGGA X_tropicalis300095 -------CTGCAATGATG-A---------CTTTCTTAGGACACCTTTGGA X_tropicalis300096 -------TTGCAGTGATGAC----------TATCTTAGGACACCTTTGGA X_tropicalis300097 -------TGGCAATGATGAC----------TATCTTAGGACACCTTTGGA X_tropicalis300098 -------TGGCAATGATGAC----------TATCTTAGGACACCTTTGGA * * * C_elegans300009 CTCCAAAGGTGTCCTAAGTAAGTCATCACAACTCTTG------- C_familiaris300364 -------TTAACCGTGAGAAC--AG--CTATCAGCTGAGCGGC- C_familiaris300365 ------TTTTACTATGAAA---ATGAAACTGTT-CTGAGCGGT- C_familiaris300366 -------TTAACCATGAAAAGAAAC-TGT--GTTCTGAGCAAC- C_porcellus300623 -------ATCACCATGAAAG---GAAAACTATT-CTGAGCAAC- C_porcellus300624 -------TTTACCATGAAAAT--AAATAAAATT-CTGAGCAGC- C_porcellus300625 -------TTAATAATGAAAAT--AA--TTACTGTCTGAGCAGC- D_rerio300093 GGTT--ATGACTAATGAAAAG--AA-AACATGTTCTGAGTACT- D_rerio300094 GGAT--ATGACCAATGAAAAG--AA-AACATGTTCTGAGTACG- D_rerio300186 GGTT--ATGGCCAGTGAGAAA--AACAACACTTTCTGAGTGCG- D_novemcinctus300499 -------ATAACCATGAAAGA--AAA--TTTTTTCTGAGCAAC- D_novemcinctus300500 ------ATTTACCATGAAAAT----GAACAAGTTCTGAGCAGT- D_novemcinctus300501 -------TTACTCATGAAAAA--AA--CTAGTATCTGAGGAAC- D_melanogaster300080 ATGC--CTTGATTAGTGTAAAG--TTATGTTTTTCTGATAACAA D_melanogaster300081 ATGC--CTTGATTAGCGTAAA----CGTCAATATCTGATAAA-- E_telfairi300757 -------ATAACCATGAAA--ACACAATTATATTCTGAGCAAC- E_telfairi300758 -------TTAACCATGAAAA----TGATAACATTCTGAGCAGC- E_telfairi300759 -------TAAACCGTGGAAAC--CG--CCACC-GCCGAGCAGC- E_caballus300026 -------TTAATCATGAAAAC--AA--CTACTCTCTGAGCAGC- E_caballus300279 -------ACAACCGTGAAAG----AATACTATT-CTGAGCAAC- E_caballus300280 -------TTAACCATGAAAA----AAACAATGTTCTGAGCAAC- E_caballus300281 ------TTTA-CAGTGAAT---ATTAATCAGTT-CTGAGCAGC- E_europaeus300087 ------TATA-TCATGAAA---ACAAACCAGTT-CGTGGT---- E_europaeus300517 -------ATAACCGTGAAAAA--GAAAACTGTT-CTGAGCAAC- E_europaeus300580 ------TTTA-CCGTGAAA---ACAAACCAGTT-CTGAGCAGC- F_catus300280 ------TTTA-CCATGAAA---ACTAATCAGTT-CTGAGCAGT- F_catus300281 -------TTAACCGTGAAAAC--AA--CTACTTTCTGAGCGGC- G_gallus300115 -------ATACCCATGGAATA--AAAAGTTATTACTGAGCAAC- G_gallus300116 ------A-CAACCATGAAATAATAACTACTTT--CTGAGTCAT- G_gallus300118 -------TTCAATGTGAAAAGAAACTTGT--ATTCTGAGCAAT- G_gallus300119 ------A-CAACCATGAAATAATAACTTTTTTTTCTGAGCCAT- G_gallus300120 -------ATACTCATGAAAAA--AAATGTTATTTCTGAGCAAC- G_aculeatus300145 ------ATTCTACATGAAGATTAAAGATGAAAT-CTGAGCTGT- H_sapiens300240 -------ATAACTATGAAAG----AAAACTATT-CTGAGCAAC- H_sapiens300241 -------TTAATAATGAAAAC--AA--CTACTCTCTGAGCAGC- H_sapiens300468 -------TTTACCGTGAAAA---TTAATAAATT-CTGAGCAGC- L_africana300337 -------ATAACCATGAAAG-----AAAACATT-CTGAGCAAC- L_africana300447 -------TTAACCATGAAA--AAAAAA--ATATTCTGAGCAAC- M_mulatta300683 -------ATAACTATGAAAG----AAAACTATT-CTGAGCAAC- M_mulatta300684 -------TTTACCGTGAAAA---TTAATAAATT-CTGAGCGGC- M_mulatta300685 -------TTAATCATGAAAAC--AA--CTACTCTCTGAGCAGC- M_murinus300032 -------ATAACCATGAAAGA--AAAC---TATTCTGAGCAAC- M_murinus300033 -------TTAATCATGAAAC----A--CTACTCTCTGAGCAGC- M_murinus300307 -------TTAATCATGAAAAC--AA--CTACTATCTGAGCAGC- M_murinus300563 -------TTAACCATGAAAGA---CACCTTGATGTTGGATAAA- M_domestica300053 -------TTAACCATGAAAA---CAATGATAATTCTGAGCAGC- M_domestica300140 -------ATAACCATGAAAAA--AAACATGTATTCTGAGCAAC- M_domestica300141 ------TTAAGCAATGAAA--ATAATTACTAC--CTGAGCCAT- M_domestica300142 ------TTAAATAATGAAAAA---AAAATATGTTCTGAGCAAT- M_domestica300143 -------TTAACAATGAAA---ATAAAAACAATACTGAGCAGC- M_musculus300308 -------TTAATCATGAAAAT--AA--CTATCCTCTGAGCAGC- M_musculus300733 -------TTAATCATGAAAAT--AA--CTATCCTCTGAGCAGC- M_musculus300734 -------TTTACCGTGAAAA---GAAGTAACCT-CTGAGCAGC- M_musculus300735 -------TTAACCGTGAAATC----AAACAAGTGCTGAGCAAC- M_lucifugus300973 -------ATAACCATGAAAG----GAAACTATT-CTGAGCAAC- M_lucifugus300974 -------TTGACCGTGAAAA----AAACCATGTTCTGAGCAAC- M_lucifugus300975 -------TTGACCATGAAAA---CCAATCAATT-CTGAGCAGC- M_lucifugus300976 -------TTCACCGTGAAAAC--AG--CGGTTCTCTGAGCAGC- O_anatinus302248 -------TTAACTGTGAAAAC-A--AGGAAATT-CTGAGCAGC- O_anatinus302249 -------TTAACTGTGAAAAT-ACTAAAACATT-CTGAGCAGC- O_anatinus302250 -------TTAATCGTGAAAATAAATTTCT--ATTCTGAGCAAC- O_anatinus302251 ------TTAA-CAATGAAA--ACAATCATCGA--CTGAGCCAT- O_anatinus302252 -------TTAACCGTGAAAAGAAA--TAT--ATTCTGAGCAAT- O_cuniculus300177 -------ATAACCGTGAAAG----GAAATTGTT-CTGAGCAAC- O_cuniculus300178 ------GTTAGCCGTGAAATA-ACCAATCAGTT-CTGAGCGGC- O_cuniculus300429 -------TTAACCGTGAAATA----AAACACGTTCTGAGCAAC- O_latipes300095 -------TTCTCCATGAAAACAACT-TCT--GACCTGAGCAGC- O_latipes300096 ------AATAAAGATGAAAAG-ACGAAAGAAAG-CTGAGCAGT- O_garnettii300186 -------TTTACCGTGAAGA---TTAATACACT-CTGAGAAGC- O_garnettii300196 -------TTTACCGT------------TAAATT-CTGAGCAGC- O_garnettii300299 -------TTAACCATGAAAAC--AA--CTACTCTCTGAGCAGC- O_garnettii300337 -------TTAACCGTGAAAG----GAAACTATT-CTGAGCAAC- O_garnettii300636 -------TTTACCATGAAAAA--TTAATAAACC-CTGAGCAGC- P_troglodytes300053 -------ATAACTATGAAAG----AAAACTATT-CTGAGCAAC- P_troglodytes300054 -------TTAATAATGAAAAC--AA--CTACTCTCTGAGCAGC- P_troglodytes300555 -------TTAATTATGAAAAC--AA--CTACTCTCTGAGCAAT- P_troglodytes300681 -------TTTACCGTGAAAA---TTAATAAATT-CTGAGCAGC- P_pygmaeus300050 -------ATAACTATGAAAG----AAAACTATT-CTGAGCAAC- P_pygmaeus300556 -------TTAATTATGAAAAC--AA--CTACTCTCTGAGCAAT- P_pygmaeus300681 -------TTTACCGTGAAAA---TTAATAAATT-CTGAGCAGC- R_norvegicus300987 -------TTAATCATGAAAAT--AG--CTCTTCTCTGAGCAGC- R_norvegicus300988 -------TTTACCGTGAAAA---TAAGTAAAAT-CTGAGCAGC- R_norvegicus300989 -------TTAACCGTGAAATA----AAACATGTTCTGAGCAAC- S_araneus300543 -------ATAACCGTGAAAG---GAAAACTGTT-CTGAGCAAC- S_araneus301071 -------TTGACCGTGAAAA----AAAAAATGTTCTGAGCAAC- S_tridecemlineatus300072 -------TTAATCATGAAAAC--AA--CTATTCTCTGAGCAGC- S_tridecemlineatus300244 -------TTTACCATGAAAA---CTAATACATT-CTGAGCAGC- S_tridecemlineatus300245 -------TTAACCATGAAATA----AACCATGTGCTGAGCAAC- T_nigroviridis300034 -------TTAGTCATGAAAATAAAAGTGAATTACCTGAGCAAA- T_nigroviridis300035 -------TAAACGATGAAACT---ACTCATGTGTCTGAGCACC- T_nigroviridis300036 -------TGAACCATGAAAACAAAC-TGTTAAACCTGAGCAGC- T_belangeri300223 -------ATAACCATGAAAGC--ACA--TTATT-CTGAGCAAC- T_belangeri300224 -------TTCATCATGAAAAC--AA--CTATTTTCTGAGCAGC- T_belangeri300240 ------ATCATCA-TGAAAAC--AA--CTACTCTCTGAGTAGC- T_belangeri300281 ------ATCATCA-TGAAAAC--AA--CTACTCTCTGAGTAGC- T_belangeri300322 -------TTTACCATGAAAA---GTAATAAATT-CTGAGCAGC- X_tropicalis300095 A-----ATAAAAGATGAAAATAACACTTATAATACTGAGCAGT- X_tropicalis300096 -------AAACCCATGAAAC-AAAAAATTTTATTCTGAGCGAC- X_tropicalis300097 ------ATCAAACATGAAACCA-ACCTTAATT--CTGAGCCAC- X_tropicalis300098 ------ATCAAACATGAAACCA-AACTTCATT--CTGAGCCAC-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved