snOPY snoRNA Orthological Gene Database

Family: SNORD56

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300183 AGGAAATGATGTTTATTTATTGTCATCTGATTTGCATTCCATATTTGGAT C_familiaris300211 CTGCAATGATGGC-AGTATTTTTCGTC--AACAGCAGTTCA--CATG--- C_familiaris300450 CTACAATGATGGC-AGTATTTTTCGTC--AACAGCAGTTCA--CTTA--- C_porcellus300830 CTACAATGATGGT-AATATTTTTCGTC--AACAG-AGTTC-----TA--- D_novemcinctus300474 CTACAATGATGGC-AATATTTTTTGTC--ATCAGCAGTTCA--CCTATAG D_novemcinctus300582 CTACAATGAT-GGCAATATTTTTCGTC--AACAGCAGTTCA--CCTATTG E_telfairi300041 GCACAGTGATGGT-ACTATTTTTTGCC--AACAGCAGTTCA--CCTA--- E_caballus300256 CTACAATGAT-GCCAGTATTTTTCGTC--AACAGCAGTTCA--CCTA--- E_europaeus300178 CTACAATGAT-GTCAGTATTTTTCATC--AATAGCAGTTCA--CCTG--- E_europaeus300524 CTACAATGATGTC-AGAATTTTTCATC--AACAGCAGTT----------- E_europaeus300602 CTACAATGAT-GTCAGTATTTTTCGTC--AACAGCAGTTCA--CCTA--- E_europaeus300717 CTACAATGAT-GTCAATATTTTTCATC--AACAGCAGTTCA--CCTA--- E_europaeus300718 CTACAATGAT-GTCAATATTTTTCATC--AACAGCAGTTCA--CCTA--- F_catus300040 CTACAGTGATAAC-AGTATTTTTTGTT--AACAACAGTTCA--CCTA--- F_catus300083 CTGCAATGATGGC-ACTATTACTGGTC--AACAGCAGTTCA--CCTC--- F_catus300193 CTACAATGATGGCAGC-ATTTTTCGTC--AATAGCAGCTCA--CCTA--- F_catus300312 CTACAATGAT-GGCAATATTTTTCGTC--AACAGCAGTTCA--CCTA--- H_sapiens300478 CCACAATGATGGC-AATATTTTTCGTC--AACAGCAGTTCA--CCTA--- L_africana300441 CTACAATGAT-GGCAATATTTTTCGTC--AACAGCAGTTCA--CCCA--- L_africana300478 CTACAATGAT-GGCAATATTTTTCATC--AACAGCAGTTCA--CCCA--- M_mulatta300005 CCACAATGATGGC-AATATTTTTCAAC--AACAGAAATTAA--CCTC--- M_mulatta300119 CTATTAGGATGACAAT-ATTTTTTGCC--AGCAACAGCTCA--CCTA--- M_mulatta300281 CTACAATCATGGCAAT-ATTTTTTGTC--AACAGCAGCTCG--CCTA--- M_mulatta300462 CCACAGTGACAGC-AGTATTTTTCATC--CACAGTAGTTCA--CCTT--- M_mulatta300526 CTAAAACAATGTCAAT-AGTTTTCATC--AACAGCAGTTGAA-CCTA--- M_mulatta300529 CCACGATGATGGC-AATATTTTTCGTC--AACAGCAGTTCA--CCTA--- M_mulatta300710 CTACAAAGATGACAAT-ACTTTTCATC--AACAGCAGTTCA--CCTA--- M_murinus300030 CTATAATGATGGCAATATTTTTTTGTC--AATAGTAGCTCA--CCTA--- M_murinus300200 CTGCAATAGCAAC-AACATAAATTACC--TACAGCAATTCA--CCTA--- M_murinus300215 CTATAATGATGGCAATATTTTTTTGTC--AATAGTAGCTCA--CCTA--- M_murinus300273 CTATAATGATGGCAAT-AGTTTTCATC--AACAGCAGTTTA--CCTA--- M_murinus300436 CTGCAACGATGGC-AGTATTTTTCATT--AATAGTAGTTCA--CCTT--- M_murinus300457 CTACGATGATGGT-AGTATTTTTCGTC--AACAGCAGTTCA--CCTA--- M_murinus300574 TGACAATGGTGGCGAT-ATTTC---TC--AACAGCAGTTCG--CCTA--- M_domestica300172 CTGCAATGATGGG-AAAATTTTTCGTC--AACAGCAGTTCA--CCTT--- M_musculus300982 CTACAATGATGGT-AATATTTTTCGTC--AACAG-AGTTCA--CCTA--- M_lucifugus300478 CTACAATGATGGT-AACATTTTTCGTC--AACAGCAGTTCA--CCTA--- O_anatinus302233 CCGCCGTGATGGA-ACGATTTTTCGTC--AACAGCAGTTCAC-CCCC--- O_cuniculus300350 CTACCATGATGGT-A-TATTTTTCTTC--AACAGCAATTCT--CCTA--- O_cuniculus300410 CCACAATGATGGT-AATATTTTTCGTC--AACAGCAATTCA--CCTA--- O_garnettii300092 TTGAAATAATGGC-AATGTGTTTAATC--AATAACAGTTCA--CCTA--- O_garnettii300391 CTAATGTTAAGACCTC-TTTTTGCGTC--AACAGCAGATCA--TCTA--- O_garnettii300401 CTATGATGATGGCACT-ATTTTTCATC--AACAGCAGTTCA--CCTA--- O_garnettii300526 TTACAATGATGGCAAT-ATCTTCCATC--AACAGCAGTTTA--C-TA--- O_garnettii300657 CTACGATGATGGT-ACTATTTTTCGTC--AACAGCAGTTCA--CCTA--- O_garnettii300667 CTGCAATGATGGC-AGTATTTTTCAGT--CACATCAGTTTA--CCTA--- P_troglodytes300057 CTACAATGATGAC-AATATTTTTCATC--AACAGAAATTAA--CCTA--- P_troglodytes300152 CTATTAGGATGACAAT-ATTTTTTGTC--AGCAGCAGCTTA--CCTA--- P_troglodytes300160 CTACAATGAT-GGCAATATGTTTCATC--GACAGCAGTTCA--CCCA--- P_troglodytes300250 CTACAATCATGGCAAT-ATTTTTTGTC--AACAGCGGTTCA--CCT---- P_troglodytes300542 CTACAAAGATAGCAAC-ACTTTTCATC--AACAGCAGTTCG--CCTA--- P_troglodytes300723 CCACAATGATGGC-AATATTTTTCGTC--AACAGCAGTTCA--CCTA--- P_troglodytes300727 CTAAAACAATGTCAAT-AATTTTCATC--AACAGCAGTTGAA-CCTA--- P_troglodytes300469 CCACAGTGACAGC-AATATTTTTCATC--CACAGT---TCA--CCTC--- P_pygmaeus300215 CCACAGTGACAGC-AATATTTTTCATC--CACAGT---TCA--CCTC--- P_pygmaeus300337 CTACAATGATGAC-AATATTTTTCATC--AACAGAAATTAA--CCTA--- P_pygmaeus300339 CTACAATCATGGCAAT-ATTTTTTGTC--AACAGCAATTCA--CCTA--- P_pygmaeus300347 CTACAATGAT-GGCAATGTTTTTCATC--GACAGCAGTTCA--CCCA--- P_pygmaeus300579 CTACCAAGATGGCAAC-ACTTTTCATC--AACAGCAGTTCA--CCTA--- P_pygmaeus300624 CCACAATGATGGC-AATATTTTTCGTC--AACAGCAGTTCA--CCTA--- P_pygmaeus300627 CTAAAACAATGTCAAT-AGTTTTCATC--AACAGCAGTTGAA-CCTA--- P_pygmaeus300427 CTATTAGCATGACAAT-ATTTTTTGTC--AGCAGCAGCTTA--CCTA--- R_norvegicus300952 CTACAATGATGGT-AATATTTTTCGTC--AACAG-AGTTCA--CCTA--- S_tridecemlineatus300037 CTACAATGATAGTTAATATTTTCCATC--AGTAGCAATTCA--CCTA--- S_tridecemlineatus300312 CTACAATGATGGTTAATATTTTTCGTC--AACAGCAGTTCA--CCTA--- T_belangeri300339 CTACAATGAT-GCCAATATTTTTCGTC--AACAGCAGTTCA--CCTA--- A_thaliana300183 GTTAAGCTGGTGAATGATTCATTATAACTGATCCT C_familiaris300211 -GTGAGGGATGATA-CTTTGGGTCTGAGTGA---- C_familiaris300450 -GTGAGTGTTGAGA-CTTTGGGTCTGAGTGA---- C_porcellus300830 -ATGAGTGTTGATA-TATTGGGTCTGAGTGA---- D_novemcinctus300474 AGTGAGTGTTGATA-GTTTGGGTCTGAATGA---- D_novemcinctus300582 CGTGAGTGTTGATTAGTTTGGGTCTGAGTGA---- E_telfairi300041 -GTGAATGTTGATAGTGTTGGGTCTGAGTGA---- E_caballus300256 -GTGAGTGTTGAT-ACTTTGGGTCTGAGTGG---- E_europaeus300178 -GTGAGTGTTAATA-CCTTGGGTCTGGGTGA---- E_europaeus300524 ---GAGGGTTGATA-CTT-GGGTCTGAGTGA---- E_europaeus300602 -GTGAGTGTTGATA-CCTTGGGTCTGAGTGA---- E_europaeus300717 -GTGAGTGTTGATA-CCTTGGGTCTGAGTGA---- E_europaeus300718 -GTGAGTGTTGATA-CCTTGGGTCTGAGTGA---- F_catus300040 -GTGAGTATTGATATT-TTGGGTCTGAGTGA---- F_catus300083 -CTGCTTGTTGATC-CTTTGGGTCTGAGTGA---- F_catus300193 -GTGAGTGTTCATA-CTTTCAGTCTTAGTGA---- F_catus300312 -GTGAGTGTTGATA-CCTTGGGTCTGAGTGA---- H_sapiens300478 -GTGAGTGTTGAGA-CTCTGGGTCTGAGTGA---- L_africana300441 -GTGAGTGTTGATA-CTTTGGGTCTGAGTAA---- L_africana300478 -GTGAGTGTTGATA-CTTTGGTTCTGAGTGA---- M_mulatta300005 -GTGAGTTTTGATATT-TAGGGTATAAGTGA---- M_mulatta300119 -ATGAGTGTTGATG-CTGTGGGTCTGAATGA---- M_mulatta300281 -GTAAATGTTGATA-CTTTGGGTCTGAGTGA---- M_mulatta300462 -ATGAATGTTGACACT-TTGGGTCTGAGTTA---- M_mulatta300526 -ATAAGTTTCGATA-CTTTGGGTCTGAGTGG---- M_mulatta300529 -GTGAGTGTTGAGA-CTCTGGGTCTGAGTGA---- M_mulatta300710 -GAGAGAGTCGATA-CTTTGGGTCTGAGTGA---- M_murinus300030 -CTGAGTGTTGATA-CTTTGTATCTGAGTGA---- M_murinus300200 -GTGAGTGTTGATA-CTTTCAATCTGAGTGA---- M_murinus300215 -CTGAGTGTTGATA-CTTTGTATCTGAGTGA---- M_murinus300273 -TTAAGTGTTGATA-CTTTGGGGCTGAGTTG---- M_murinus300436 -GTGAGTGTTGATA-CTTTGGATCTGAGTGA---- M_murinus300457 -GTGAGGGGTTGATACTTCGTGTCTGATTGA---- M_murinus300574 -GCACATGTTGCTA-CTTTGGGTCTGAGTGA---- M_domestica300172 -GTGAGTGTTGAAT-TTCTTAGTCTGAGCAA---- M_musculus300982 -GTGAGTGTTGACA-CCTTGGGTCTGAGTGA---- M_lucifugus300478 -GTGAGTGTTGATA-CTTTGGGTCTGAGTGA---- O_anatinus302233 -GTGAGTGTTGATAAGCCTGTGTCTGAGCGA---- O_cuniculus300350 -ATGAATGAT-GAAGCTTTGGGTCTCAGTGA---- O_cuniculus300410 -GTGAGTGTTGATA-CTCTGGGTCTGAGTGA---- O_garnettii300092 -GCAAATGTTGATA-ATTTGGGTATGATTAT---- O_garnettii300391 -GTGAGTGTTGATG-CTTTGGGTCTGAGTGA---- O_garnettii300401 -GTTAGTGTTGATA-CTTTGGGTCTGAGTGA---- O_garnettii300526 -TTAAATTTTGATA-CTTTGGGTCTGAGTGA---- O_garnettii300657 -GTGAGTGTT-GATGCTTTGGGTCTGAGTGA---- O_garnettii300667 -GTGAGTATTGATA-CTTTGGGTCTGAAAGA---- P_troglodytes300057 -GTGAGTTTCGATATT-TAGGGTATGAGTGA---- P_troglodytes300152 -ATGAGTGTTGATG-CTTTGGGTCTGAGTGA---- P_troglodytes300160 -TTGAGTATTGATA-CCGTGGGTCTGAGTGA---- P_troglodytes300250 -GTGAATGTTGATA-CTTTGGGTTTGAGTGA---- P_troglodytes300542 -GAGAGAGTCGACA-CTTTTTGTCTGAGTGA---- P_troglodytes300723 -GTGAGTGTTGAGA-CTCTGGGTCTGAGTGA---- P_troglodytes300727 -GTAAGTGTCGATA-CTTTGGGTCTGAGTGG---- P_troglodytes300469 -ATGAATGTTGTCACT-TTGGGTCTGAGTGA---- P_pygmaeus300215 -ATGAATGTTGTCACT-CTGGGTCTGAGTGA---- P_pygmaeus300337 -GTGAGTTTCAATATT-TAGGGTATGAGTGA---- P_pygmaeus300339 -GTGAATGTTGATA-CTTTGGGTCTGAGTGA---- P_pygmaeus300347 -TTGAGTGTTGATA-CCGTGGGTCTGAGTGA---- P_pygmaeus300579 -GAGAGAGTCAACA-CTTTTTGTCTGAGTAA---- P_pygmaeus300624 -GTGAGTGTTGAGA-CTATGGGTCTGAGTGA---- P_pygmaeus300627 -GTAAGTGTCGATA-CTTTGGGTCTGAGTGG---- P_pygmaeus300427 -ATGAGTGTTGAAG-CTTTGGGTCTGAGTGA---- R_norvegicus300952 -GTGAGTGTTGACA-CTTTGGGTCTGAGTGA---- S_tridecemlineatus300037 -GTGAGTGTTGATA-CCTGACCTGTGGTTAA---- S_tridecemlineatus300312 -GTGAGTGTTGATAACTCTGGGTCTGAGTAA---- T_belangeri300339 -GTGAGTGTTGAT-AATTTGGGTCTGAGTGA---- *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved