snOPY snoRNA Orthological Gene Database

Family: SNORD55

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300182 TGAATCTGAGTATAGGATGAATCTCATATATT-GATGTTATTTA-CTACT C_familiaris300436 --------CGTGGATGATGACAC---CTTCGT-AATGCGG-AAAACTCCC C_porcellus300935 --------CGTGTATGATGACAC---CTCGGT-AACGCTG-CGTACTCCC D_novemcinctus300065 --------CGTCTAGGATGACAC---CTCGGT-GATGCTGCAAA-CCCCC E_telfairi300712 --------TGTGCATGATGACAC---CTCAAT-AATTCTGTAAA-TCCCC E_telfairi300828 --------CGTGCATGATGACAC---CTCGGT-GATGCTGCAAG-TCCCC E_caballus300045 --------CGTGGATGATGACAC---CTTAGT-GATGCTG-TGGACTGCC E_europaeus300637 --------CGTGTATGATGACAC---CTTCAT-GATGCTG-C---TTGCC E_europaeus300639 --------CGTGTATGATGAAAC---CTTGGT-AATGCTGATGTGCTCCC H_sapiens300661 ---------GTGTATGATGACAA---CTCGGT-AATGCTG-CATACTCCC L_africana300339 --------CGTGCATGATGACAC---CTCGGT-AATGCTGCAAA-TCCCC M_mulatta300234 --------AGCGTATGATGACAC---CTTGGT-AATGCTGCAGA-CTCCT M_mulatta300415 --------TGAAACTATTGAGAA-----CAAA-GATGCAACATACCACTC M_mulatta300578 --------CGTGTATGATGACGA---CTCGGT-AATGCTG-CATACTCCC M_murinus300010 --------TGTGTATGACGACAC---CTCAGT-AATGCTGCAGA-CTCTA M_murinus300255 --------TGCGCATGATGACAC---CTGGGA-AATGCTGCAGA-CTGCC M_murinus300266 --------AATATACGGTGACAC---CTCAGG-AATGCTGCAGA-CTCCC M_murinus300447 --------CGCGCATGATGACAC---CTGGGA-AATGCTGCAGA-CTGCC M_domestica300076 ------GGCGCGC-TGATGACAC---CTTGGTTACTGCTGCAAACACCGA M_musculus300957 --------CGCGGATGATGACAC---CTGGGT--ATGCTG-CACACTCCC M_lucifugus300584 --------TGTGTATGATGATAC---CTTGGT-ACTACTGTAAT-CTGCC M_lucifugus300735 --------CGCGCATGATGACAG---CCTAGG-ACTGCTGTGAA-ACGCC O_garnettii300250 --------AGTGTATGATGACAC---TTTGAT-AAAGCTGAAGA-CTCCT O_garnettii300594 ------------CATGACGACACACACCCAGG-AATGCTGCAGA-CTGCC O_garnettii300686 --------CGCGCATGATGACAC---CCAGG--AATGCTGCAGA-CTGCC P_troglodytes300050 -----------AACTATTGAGAA-----CAAA-GATGCAACGTACCACTC P_troglodytes300207 --------AGTGTATCATGACAC---CTTGGT-AATGCTGCAGA-CTCCT P_troglodytes300521 --------CGTGTATGATGACAA---CTCGGT-AATGCTG-CATACTCCC P_troglodytes300645 --------GCCGTGTGAGGCCAC---CTCTGC-CACGCTGCAGG-CTCCC P_pygmaeus300376 --------CGTGTATGATGACAA---CTCGGT-AATGCTG-CATACTCCC P_pygmaeus300551 --------AGTGTATGATGACAC---CTTGGT-AATGCTGCAGA-CTCCT P_pygmaeus300597 --------CGTGTATGATGACAA---CTCGGT-AATGCTG-CATACTCCC P_pygmaeus300698 --------GCCGTGTGAGGCCAC---CTCTGC-CACGCCGCAGG-CTCCC R_norvegicus300427 --------CGCGGATGATGACAC---CTGGGT--ATGCTG-CACATTCCC S_araneus301048 --------CGTGTGTGATGACAC---CTTGGA-AATGCTG-TG-ACTCCC S_tridecemlineatus300290 --------CGTGTATGATGACAC---TTTGGT-AATGCTG-CATATTGCC T_belangeri300000 --------CGTGG-TGATGACAC---CTTGGT-AATGCTG-CAGACTTCC T_belangeri300278 --------CGTGG-TGATGACAC---CTTGGT-CATGCTG-CAGACTGCC * A_thaliana300182 GAAATTACATTGATGTTTTATTCACCTTGGAGAACTGATACTCAGATTCA C_familiaris300436 GAGTGCGCAGTGGGGGA--GCCAACCTTGGAGAGCTGAGCGTGCG----- C_porcellus300935 GACTGAGCGGTGGGGAA--GCAAACCTTGGAGAGCTGAGCGTGCG----- D_novemcinctus300065 GAGTGCGCAGTGGGGAA--GCCAACCTTGGAGAGCTGAGCGTGCA----- E_telfairi300712 ATTTGCACAGTGGGGAA--GCCAACCTTAAATAAATAAGCACATA----- E_telfairi300828 GAGTGTGCGGTGGGGAA--GCCAACCTTGGAGAACTGAGTGCG------- E_caballus300045 GAGTGCGCAGTGGGGAC--GCCAACCTTGGAGAGCTGAGCGTGCG----- E_europaeus300637 GAGTACGCCGTGTGGAG--GCCAACCTTGGAGAGCTGAGCGTGCG----- E_europaeus300639 GACTGCTCAGTGGGGAA--GCCAACCT-GGAGAGCTGAATGTG------- H_sapiens300661 GAGTGCGCGGTGGGGAA--GCCAACCTTGGAGAGCTGAGC---------- L_africana300339 GAGTGCGCGGTGGGGAA--GCCAACCTTGGAGAGCTGAGCCCGCG----- M_mulatta300234 GAGTGTGCAGTGAAGAG--GTGAACTTTGAAAAGTCACATATGTG----- M_mulatta300415 GAGTGTGCAGTGGGGAA--GCCAACCTTGGAGAGCTGAGCATGTG----- M_mulatta300578 GAGTGCGCGGTGGGGAA--GCCAACCTTGGAGAGCTGAGCGTGCG----- M_murinus300010 CAGCATGCAGTGAGGAA--GCCAATCTTGGAGAGCTCAGAGTAAT----- M_murinus300255 GAGTGCGCAGTGGGGAA--GCCAACCTTGGAGAGCTGAGCGT-GCG---- M_murinus300266 ATGCA--CAGTGGAGAA--GCCAACCTTGGACAGCTGAGTGTGCA----- M_murinus300447 GAGTGCGCAGTGGGGAA--GCCAACCTTGGAGAGCTGAGCGT-GCG---- M_domestica300076 GATCCTG--GTGGGGAT--GCAAACCTTGGAGAGCTGAGCGCCGCC---- M_musculus300957 GACTGCGTCGTGGGGAA--GCCAACCTTGGAGAGCTGAGCGTGCG----- M_lucifugus300584 GAGTGCTT------GAT--GCTCAGCTTGAAGAGCTGAGCTTGCT----- M_lucifugus300735 GATCTCG--GTGGGGAA--GCCAACCTTGGAGAGCTGAGCGC-GCC---- O_garnettii300250 ATGTGTACAGAAAGTAT--GTCAACATTGAAAATCTGAGAGAACA----- O_garnettii300594 AATTGCGCAGTGAGGAA--GCCAACCTTGGAGAGCTGAGCAT-GTG---- O_garnettii300686 GATCGTGCAGTGAGGAA--GCCAACCTTGGAGAGCTGAGCGT-GCG---- P_troglodytes300050 GAGTGTGCAGTGGGGAA--GCCAACCTTGGACAGCTGAGCATGTG----- P_troglodytes300207 CAGTGTGCAGTGAAGAG--GTGAACTTTGAAGAGTCACATATGTG----- P_troglodytes300521 GAGTGCGCGGTGGGGAA--GCCAACCTTGGAGAGCTGAGCGTGCG----- P_troglodytes300645 CAGCACGCGGTGGGGAA--CCCCACCTTGGAGAGCCGAGCCGGG------ P_pygmaeus300376 GAGTGCGCGGTGGGGAA--GCCAACCTTGGAGAGCTGAGCGTGCG----- P_pygmaeus300551 GAGTGTGCAGTGAAGAG--GTGAACTTTGAAGAGTCACATATGTG----- P_pygmaeus300597 GAGTGCGCGGTGGGGAA--GCCAACCTTGGAGAGCTGAGCGTGCG----- P_pygmaeus300698 CGGCACGCGGTGGGGAA--CCCAACCTTGGAGAGCTGAGCCGGG------ R_norvegicus300427 GACTGCGTCGTGGGGAA--GCCAACCTTGGAGAGCTGAGCGTGCG----- S_araneus301048 GACTGCGCAGTGGGGAA--TCCAACCTTGGAGAGCTGAGCGTGCG----- S_tridecemlineatus300290 GACTAAGCAGTGGGGAA--GCCAACCTTGGAGAGCTGAGCGTGCG----- T_belangeri300000 GAGT-CGCTATGGGGAA--GCCAACCTTGGAGAGCTGAGCGTGCG----- T_belangeri300278 GAGT-CGCCGTGCGGAA--GCCAACCTTGGAGAGCTGAGCGTGCG----- * * * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved