snOPY snoRNA Orthological Gene Database

Family: SNORD53

CLUSTAL 2.0.10 multiple sequence alignment A_thaliana300180 GAGGATGATGATATTGAGGCTGCTGTTCCATTGGCTGTCTGAGATACCTG C_familiaris300402 ----------ATGCTATGATGACATCCATATATGGTTTCGCTTCTGGCTG C_familiaris300403 ----------TTGCTGTGATGATTTCCATTG--GGTTTCGCATGTTGCTG C_porcellus300930 ----------ATGCTATGATGACACCCACATG-GTTTTCGCTTCTGGCTG C_porcellus300931 ----------TTGCTGTGATGACTTTCATTG--TGTTTCGCATGTTTCTG E_telfairi300867 ----------TTGCCATGATGACTTCCAGTG--GGTTTCGCATATTGCTG E_caballus300375 ----------TTGCTGTGATGATTTTCATTG--GGTTTCGCATGTTGCTG E_caballus300376 ----------ATGCTGTGATGACATCC-CATATGGTTTCGCTTCTGGCTG E_europaeus300665 ----------CTGCTATGATGACACCCACATATGGTTTCGCTTCTGGCTG E_europaeus300666 ----------TCGCTGTGATGACTT-CATTT--GGTTTCGCTTGTTGCTG F_catus300012 ----------TTGCTGTGATGATTTCCATTG--GGTTTCGCATGTTGCTG G_gallus300073 ----------ATGCAGTGATGATCTCCATCT-TGGTTTCGCTTTTTGCTG H_sapiens300496 ----------ATGCTATGATGACATCCATA--TGGTTTCGCTGCTGGCTG L_africana300487 ----------ATGCTGTGATGACATCCACG--TGGTTTCGCTTCTGGCTG M_mulatta300634 ----------ATGCTATGATGACATCCATA--TGGTTTCGCTGCTGGCTG M_mulatta300635 ----------TTGCTGTGATGACTATCATTG--G-TTTCGCATGTTGCTG M_murinus300580 ----------ATGCTATGATGACATCCAAA--TGGTTTCGCTACTGGCTG M_murinus300581 ----------TTGCTGTGATGACTTTCATTG--GGTTTCGCATGTTGCTG M_domestica300129 ----------CTGCTGTGATGACTTCCATT--TGGTTTCGCTTGTGACTG M_domestica300130 ------------GCTGTGATGATTTCATTCT--GGTTTCGCTTTTTGCTG M_musculus300919 ----------ATGCTGTGATGATATCCTCA--TGGTTTCGCGTCTGTCTG M_musculus300920 ----------TTGCTGTGATGACTGTCATTG--GGTTTCGCATATTGCTG O_cuniculus300383 ----------TTGCCGTGATGACTTCCGTTG--GGTTTCGCATGTTGCTG O_cuniculus300481 ----------ATGCTATGATGACATCCATA--TGGTTTCGCTTCTGGCTG O_garnettii300696 ----------ATGCTGTGATGACATCCAAA--TGGTTTCGCTACTGGCTG O_garnettii300697 ----------TTGCTGTGATGACTTTCATTG--G-TTTCGCATGTTGCTG P_troglodytes300595 ----------ATGCTATGATGACATCCATA--TGGTTTCGCTGCTGGCTG P_troglodytes300596 ----------TTGCTGTGATGACTATCATTG--GGTTTCGCATGTTGCTG P_pygmaeus300676 ----------TTGCTGTGATGACTATCATTG--GGTTTCGCATGTTGCTG P_pygmaeus300677 ----------ATGCTATGATGACATCCATA--TGGTTTCGCTGCTGGCTG R_norvegicus300896 ----------TTGCTGTGATGACTTTCATTG--GGTTTCGCATATTGCTG R_norvegicus300897 ----------CTGCTGTGATGATATCCACA--CGGTTTCGCGTCTGGCTG S_araneus301056 ----------GTGCAGTGATGATGTCCATA--TGGTTTCGCTTCTGGCTG S_araneus301057 ----------TTGCTGTGATGACTTCCATTG--GGTTTCGCTTGTTGCTG S_tridecemlineatus300287 ----------ATGCTATGATGACAACCACATG-GTTT-CGCTTCTGGCTG T_belangeri300384 ----------ATGCTATGATGACATCCGTT--TGGTTTCGCTTCTGGCTG T_belangeri300385 ----------TTGCTGTGATGACTTCCATTG--GGTTTCGCATGTTGCTG X_tropicalis300016 ----------CTGCAGTGATGAGTTGCCTCT--GGTTTCGCTTGTGTCCG * * * * * * A_thaliana300180 CAGTTCGTGATCGTGACCTGTAAGTTTTGA--GGCAGAGCGTTTAGTTTC C_familiaris300402 -AGT-TCCAGAGATGACACCTTTCTCTTGGCTGTCTGAGCAT-------- C_familiaris300403 -ACT-TCCAGTGATGCCTCTT--CTCTTGGCTGTCTGAGCAG-------- C_porcellus300930 -AGT-TTCAGAGATGACACCTTTCTCTTGGCTGTCTGAGCAT-------- C_porcellus300931 -AGT-TCCAGTGATACCTCTTT-CTCTTGGCTGTCTGAGCAA-------- E_telfairi300867 -AGC-TCCAATGATGACTCTT--CTCTTGGCTGTCTGAGCAG-------- E_caballus300375 -ACT-TCCGATGATGCCTCTT--CTCTTGGCTGTCTGAGCAA-------- E_caballus300376 -AGT-TTCAGAGATGACACCTTTCTCTTGGCTGTCTGAGCAT-------- E_europaeus300665 -AGC-TTCAGAGATGACACCTTTCTCTTGGCTGTCTGAGCAT-------- E_europaeus300666 -AGT-TTCAGTGATGCCTCTT--CTCTTGGCTGTCTGAGCAG-------- F_catus300012 -AGT-TCCAGTGATGCCTTTT--CTCTTGGCTGTCTGAGCAG-------- G_gallus300073 -AGT-TCCAGTGAAGACTCATTTCTCTTGGCTGTCTGAGCAT-------- H_sapiens300496 -AGT-TTCAGAGATGACACCTTTCTCTTGGCTGTCTGAGCAT-------- L_africana300487 -AGT-TTCAGTGATGACAC--TTCTCTTGGCTGTCTGAGCAT-------- M_mulatta300634 -AGT-TTCAGAGATGACACCTTTCTCTTGGCTGTCTGAGCAT-------- M_mulatta300635 -AGT-TTCAGTGATGCCTCTTTTCTCTTGGCTGTCTGAGCAA-------- M_murinus300580 -AGT-TTCAGAGATGACACCTTTCTCTTGGCTGTCTGAGCAT-------- M_murinus300581 -AGT-TCCAATGATGCCTCTTTTCTCTTGGCTGTCTGAGCAG-------- M_domestica300129 -AGT-TTCAGAGCTGATGCTTCTCTCTTGGCTGTCTGAGTGG-------- M_domestica300130 -AAT------TCGTGATGCCTTTCTCTTGGCTGTCTGAGCAT-------- M_musculus300919 -AGT-CTCAGAGATGACACCTTTCTCTTGGCTGTTTGAGCAT-------- M_musculus300920 -AGT-TCCCATGATGCCTCTT--CTCTTGGCTGTCTGAGCAG-------- O_cuniculus300383 -AGC-CCCAGTGATGCGTCCT--CTCTTGGCTGTCTGAGCAG-------- O_cuniculus300481 -AGT-TTCAGAGATGACACCTTTCTCTTGGCTGTCTGAGCAT-------- O_garnettii300696 -AGT-TTCAGAGATGACACCTT-CTCTTGGCTGTCTGAGCAT-------- O_garnettii300697 -AGG-TCCAGTGATGCTCTTTT-CTCTTGGCTGTCTGAGCAG-------- P_troglodytes300595 -AGT-TTCAGAGATGACACCTTTCTCTTGGCTGTCTGAGCAT-------- P_troglodytes300596 -AGT-TCCAGTGATGCCTCTTTTCTCTTGGCTGTCTGAGCAA-------- P_pygmaeus300676 -AGT-TCCAGTGATGCCTCTTTTCTCTTGGCTGTCTGAGCAA-------- P_pygmaeus300677 -AGT-TTCAGTGATGACACCTTTCTCTTGGCTGTCTGAGCAT-------- R_norvegicus300896 -AGT-TCCCATGATGCCTCTT--CTCTTGGCTGTCTGAGCAA-------- R_norvegicus300897 -AGT-TTCAGAGATGACACCTTTCTCTTGGCTGTCTGAGCAT-------- S_araneus301056 -AGT-CTCAGAGATGACACTTTTCTCTTGGCTGTCTGAGCAT-------- S_araneus301057 -AGTTCCCAGTGATGCCTCTT--CTCTTGGCTGTCTGAGCGG-------- S_tridecemlineatus300287 -AGT-TTCAGAGATGACACTTTTCTCTTGGCTGTCTGAGCAT-------- T_belangeri300384 -AGT-TTCAGAGATGACACCTTTCTCTTGGCTGTCTGAGCAT-------- T_belangeri300385 -AGT-TCCAGTGATGCCTCTTTTCTCTTGGCTGTCTGAGCAG-------- X_tropicalis300016 -ACA-AGCTGTGACGACGCATCTCTCTTGGCTGTCTGAGCAG-------- * * *** * *** A_thaliana300180 GGAAGAAGCTGCAGGTTCTGACA C_familiaris300402 ----------------------- C_familiaris300403 ----------------------- C_porcellus300930 ----------------------- C_porcellus300931 ----------------------- E_telfairi300867 ----------------------- E_caballus300375 ----------------------- E_caballus300376 ----------------------- E_europaeus300665 ----------------------- E_europaeus300666 ----------------------- F_catus300012 ----------------------- G_gallus300073 ----------------------- H_sapiens300496 ----------------------- L_africana300487 ----------------------- M_mulatta300634 ----------------------- M_mulatta300635 ----------------------- M_murinus300580 ----------------------- M_murinus300581 ----------------------- M_domestica300129 ----------------------- M_domestica300130 ----------------------- M_musculus300919 ----------------------- M_musculus300920 ----------------------- O_cuniculus300383 ----------------------- O_cuniculus300481 ----------------------- O_garnettii300696 ----------------------- O_garnettii300697 ----------------------- P_troglodytes300595 ----------------------- P_troglodytes300596 ----------------------- P_pygmaeus300676 ----------------------- P_pygmaeus300677 ----------------------- R_norvegicus300896 ----------------------- R_norvegicus300897 ----------------------- S_araneus301056 ----------------------- S_araneus301057 ----------------------- S_tridecemlineatus300287 ----------------------- T_belangeri300384 ----------------------- T_belangeri300385 ----------------------- X_tropicalis300016 -----------------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved