snOPY snoRNA Orthological Gene Database

Family: SNORD52

CLUSTAL W (1.83) multiple sequence alignment C_elegans300006 ---------GACAATGATAGG-----ATAACCTAGAGTCTCTGAACCATT C_elegans300056 ---------------GACATAAT----TAGATTCG-GTTATTGA----TT C_familiaris300225 ---------GGGAATGATG-ATT-TCTCAGACTAGAGTCTCTGA-----C C_familiaris300275 ---------GAGAATGATG-ATT-TCTCAGGCTAGAGTCTCTGA-----C C_porcellus300735 ---------GGGAATGATG-ATT-TCACAGACTAGAGTCTCTGA-----C D_rerio300141 ---------TGCAGTGAT--GATTCCATAGACTAGAGTCTCTGA------ D_rerio300142 ---------TGTTATGAT--GAATCTTTAGACTAGAGTCTCTGA------ D_rerio300143 ---------TGTAATGAT--GAATCATTTGACTAGAGTCTCTGA------ D_rerio300268 ---------TGTTATGAT--GAATCTTTAGACTAGAGTCTCTGA------ D_rerio300269 ---------TGTCATGAT--GAACCATTTGACTAGAGTCTCTGA------ D_rerio300270 ---------TATAATGAT--GAATCATTTGACTAGAGTCTCTGA------ D_rerio300271 ---------TGTAATGAT--GAATCATTTGACTAGAGTCTCTGA------ D_rerio300272 ---------TGTAAAGAT--GAATCATTTGACTAGAGTCTCTGA------ D_novemcinctus300048 ---------AAAAATGATG--ATTTCACAGATGATAAACATAAA------ E_telfairi300684 ---------GGGAATGATG-ATT-TCTCAGACTAGAGTCTCTGA-----C E_caballus300006 ---------GGGAATGATG-ATT-TCTCAGACTAGAGTCTCTGA-----T E_europaeus300567 ---------GGGAATGATG-ATT-CTTAAGACTAGAGTCTCTGA-----C F_catus300070 ---------GGGAATGATG-ATTGTCTCAGACTAGAGTCTCTGA-----T H_sapiens300529 ---------GGGAATGATG-ATT-TCACAGACTAGAGTCTCCGA-----T L_africana300452 ---------GGGAATGATG-ATT-TCTCAGACTAGAGTCTCTGA-----T M_mulatta300240 ---------GGGAATGATG-ATT-TCACAGACTAGAGTCTCTGA-----T M_murinus300520 ---------GGGAATGATG-ATT-TCACAGACTAGAGTCTCTGA-----C M_domestica300055 ---------GGGAATGATG-AGTTTTTCAGACTAGAGTCTCTGA-----C M_musculus300615 ---------GAGAGTGATG-ATT-TCACAGACTAGAGTCTCTGA-----C M_musculus300617 ------GGGTATGATGACCCACATTTACAGACTAGAGTTTCTGA------ M_lucifugus300347 ---------GGGAATGATG-AGT-TCTCAGACTATAGTCGCTGA-----T M_lucifugus300662 ---------GGGAATGATG-ATT-TCTCAGACTAGAGTCTCTGA-----C M_lucifugus300942 ---------GGGAATGATG-AGT-TCTCAGACTATAGTCGCTGA-----C O_cuniculus300408 ---------GGGGATGATG-ATT-TCACAGACTAGAGTCTCTGA-----C P_troglodytes300488 ---------GGGAATGATG-ATT-TCACAGACTAGAGTCTCCGA-----T P_pygmaeus300703 ---------GGGAATGATG-ATT-TCACAGACTAGAGTCTCCGA-----T R_norvegicus300415 ---------GAGAATGATG-ATT-TCACAGACTAGAGTCTCTGA-----C S_cerevisiae300011 TCCCTTGATGACCAAAATAAATTTTTACAAACTAGAGTTTCTGAATC-TT S_araneus300944 ---------GGGAATGATG-ATT-TCACAGACTAGAGTCTCTGA-----C S_tridecemlineatus300232 ---------GTGAATGCTG-AT------AGATTAGAGTCTCTGA-----T S_tridecemlineatus300253 ---------GAGAATGATG-AAT-TTACAGACTAGAGTCTCTGA-----G T_belangeri300406 ---------TGGAATGATG-ATT-TCACAGACTAGAGTCTCTGA-----T * C_elegans300006 TCGTGTTTGCAAAAACAATGCTCCTTGTCTGAGTC---- C_elegans300056 ATTTTAATTTCAAACTAACTTCTGTGTT----------- C_familiaris300225 AC-TGGTCTTGATGTCAAAAATTACGTTCTGACTC---- C_familiaris300275 AC-TGGTCTTGATGACAAAAATTAAGTTCTGACTC---- C_porcellus300735 AC-TGGTTCTGATGTCAAAAAT-AATGTCTGACTC---- D_rerio300141 -TAACAACATGAAGATCTACACATTTCTCTGAGCA---- D_rerio300142 -TTTCTCCATGAAGCTCTTCACAGTGCACTGAACA---- D_rerio300143 -TTTAAGAATGAAGTTCTTCACAGTGCACTGAACA---- D_rerio300268 -TTTACTTATGAAGCTGTTCACAGTGCACTGTACA---- D_rerio300269 -TTTACCCATGAAGCTCTTCACAGTGCACTGAACA---- D_rerio300270 -TTTTCCCATGAAGCTCTTCACAGTGCACTGAACG---- D_rerio300271 -TTTAACTATGAAGTTCTTCACAGTGCACTGAACT---- D_rerio300272 -TTTCTCCATGAAGCTCTTCACAGTGCACTGAACA---- D_novemcinctus300048 ---TGCAGGCAGCGCTGACTATTTTAATTT--------- E_telfairi300684 ---TGGTCTTGATG-TCTT-TTTGTTGTCTGACTC---- E_caballus300006 GC-TGGTTCTGATGTCAAAACTTAAGTTCTGACTC---- E_europaeus300567 GC-TGGTTCTGATGGCAGAAATTAGTTTCTGATTC---- F_catus300070 GC-TGGACTTGATGTCAAAAATTAAGTTCTGACTC---- H_sapiens300529 GC-TGGTCATGATG-TCAAAACTAAGTTCTGA------- L_africana300452 GC-TGGTCTTGATGTCAAAAAT-AAATTCTGACTC---- M_mulatta300240 GC-TGGTCATGATG-TCAAAACTAAGTTCTGACTC---- M_murinus300520 ACATGGTCATGATG-TCAAAACTAAGTTCTGACTC---- M_domestica300055 ATCTG-CCTTGGAGACAAGAAAACCACTCTGACCC---- M_musculus300615 GC-TGTCCTTGATG--TCAGCTATAAATCTGACTC---- M_musculus300617 -TGTCCACGTGACGCCACTCCTTGTA-ACTGACCC---- M_lucifugus300347 GT-TGGTTCTGAAGTGAAAA-----GTTCTGACTC---- M_lucifugus300662 GC-TGGCTCTGAAGTGAAAAATTAAGTTCTGACTC---- M_lucifugus300942 GC-TGGTTCTGAAGTGAAAA-----GTTCTGACTC---- O_cuniculus300408 CC-TGGTCCTGATGTCAAAAAT-GAGTTCTGACTC---- P_troglodytes300488 GC-TGGTCATGATG-TCAAAACTAAGTTCTGACTC---- P_pygmaeus300703 GC-TGGTCATGATG-TCAAAACTAAGTTCTGACTC---- R_norvegicus300415 TC-TGCCCTTGATG--TCAACTATAAATCTGACTC---- S_cerevisiae300011 TTGTGATTAGAACGTTTATTCTTATT-TCTGAGGTTTTT S_araneus300944 AC-TAGGCCTGATG-TCAAATTTACATTCTGACTC---- S_tridecemlineatus300232 GC-TG---TTGATGGGCTAAATAAAAAGAAGGATGT--- S_tridecemlineatus300253 GC-TGGTCCTGATG-TCAAAAGTAAGTTCTGACTC---- T_belangeri300406 GC-TGGTTCTGATG--CCAAATGCAAGTTCTGACCC---

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved