snOPY snoRNA Orthological Gene Database

Family: SNORD51

CLUSTAL W (1.83) multiple sequence alignment C_elegans300119 ------GCGCAATGAAT---GTTTAA----CCATCTTTCGGCTGA----- C_familiaris300381 CTGGTTATATGATGAATAAAATCAAA-TCACCATCTTTCGGCTGA----- E_caballus300392 CCTGTTACATGATGAATAAAATCAAA-TCACCATCTTTCGGCTGA----- F_catus300229 ACTTAAAAATGATGAGTAAAACCAAA-TCACCATCTTTCGGCTGA----- G_gallus300097 CTGGTTACATGATGAATAAAACAAAAATCACCATCTTTCGGCTGAC---- H_sapiens300506 ---GTTGCATGATGAATAAAATCAAA-TCACCATCTTTCGGCTGA----- L_africana300446 CTGCTTATGTGATGAATCAAATCAA--TCACCATCTTTCGGCTGA----- M_mulatta300561 AAGGTTGTTACATGAATAAAATCAGA-TCACCATCTTTTAGCTA------ M_mulatta300734 CTGGTTGCATGATGAATAAAATCAAA-TCACCATCTTTCGGCTGA----- M_murinus300571 CTGGTTCTATGATGAATAAAATCAAA-TCACCATCTTTCGGCTGA----- M_domestica300180 CTGGCTACATGATGAATAAAATCTAA-TCACCATCTTTCGGCTGA----- M_musculus300784 CTGGGTACATGATGAATAAAATCAAA-TCACCTTCTTTCGGCTGA----- M_lucifugus300809 CTGGTTACGTGATGAATGAAATCAAA-TCACCATCTTTCGGCTGAACTTA O_anatinus304357 CTGGCTACATGATGAATCAAATCAAA-TCACCATCTTTCGGCTGA----- O_garnettii300164 ---------CAGTATATATGGTTCAG-AAGAGGTTTTTTAGCTGA----- O_garnettii300615 CTGGTTCCATGATGAATAAAATCAAA-TCACCATCTTTCGGCTGA----- P_troglodytes300561 ---ATTGTTACATTGATAAAATCAAA-TCACCATCTTTTAGCTAA----- P_troglodytes300640 --GGTTGCATGATGAATAAAATCAAA-TCACCATCTTTCGGCTGA----- P_pygmaeus300694 CTGGTTGCATGATGAATAAAATCAAA-TCACCATCTTTCGGCTGA----- P_pygmaeus300792 AAGGTTGTTACATTAATAAAATCAAA-TCAGCATCTTTTAGCTAA----- R_norvegicus300852 CTGGGTACATGATGAATAAAATCGAA-TCACCATCTTTCGGCTGA----- S_araneus300913 CTGGTTGTGTGATGAATAAAATCAAA-TCACCATCTTTCGGCTGA----- S_tridecemlineatus300078 ATGGTCATATGATGAATAGAATCAAA-TCGCCATCTGTCAGATGA----- T_nigroviridis300022 ---GACTTCCAATGA--TGATTTATTTTCACCATCTTTCGGCTGA----- T_belangeri300382 CTGGTTACATGATGAATAAAATCAAA-TCACCATCTTTCGGCTGA----- * * * * * * C_elegans300119 -ATCCATGATGCCAATTTTCAAAATACTGAGCGCAT----- C_familiaris300381 -GCTCCTGATGGATTTG---CTTTTTCTGATAAAACTG--- E_caballus300392 -GCTCCTGATGGATTTG--CTTTTTTCTGATACAGTTG--- F_catus300229 -GCTCGTGATGGATTTG--CTTTTTTCTGATGAGACT---- G_gallus300097 -AGCTGTGATG-ATTTG--TTTCTTTCTGAGTAGATGCCAG H_sapiens300506 -GTTCGTGATGGATTTG--CTTTTTTCTGATT--------- L_africana300446 -GCTCGTGATGGATTTG--TTTTTTTCTGATAAAGCTG--- M_mulatta300561 -GCTTGTGATGGATTTGC-TTTTTTTCTGATAAACCTG--- M_mulatta300734 -GTTCGTGATGGATTTG--CTTTTTTCTGATTAAGCCA--- M_murinus300571 -GCTCGTGATGGATTTG--CTTTTTTCTGATGAAGCTG--- M_domestica300180 -GTTCGTGATGGAATTG--CTTTTTTCTGATTGGCTG---- M_musculus300784 -GCTCCTGATGGATTTG---CTTTTTCTGATAAATCTG--- M_lucifugus300809 AGCTCATGATGGATTTGCTTTTTTTTCTGATAAAGCTG--- O_anatinus304357 -GATCGTGATGGATCTG--CTTTATTCTGACCAAGCTG--- O_garnettii300164 -GCTCATGATGGATTTG--CTTTTTTCTGATAAAGCTG--- O_garnettii300615 -GCTGGTGATGGATTTG--CTTTTTTCTGATAAAGCTG--- P_troglodytes300561 -GCTTGTGATGGATTTGC-TTTTTTTCTGATAAAGATG--- P_troglodytes300640 -GTTCGTGATGGATTTG--CTTTTTTCTGATTAAGC----- P_pygmaeus300694 -GTTCGTGATGGATTTG--CTTTTTTCTGATTAAGCCA--- P_pygmaeus300792 -GCTTGTGATGGATTTGC-TTTTTTTCTGATAAAACTG--- R_norvegicus300852 -GCTCCTGATGGATTTG--CTTTTTTCTGATGTCCAG---- S_araneus300913 -GTTCCTGATGGATTTG--CTTTTTTCTGATAACAG----- S_tridecemlineatus300078 -GTTCATGATGGATGTG--CTTTTCTCTTATGAGGATC--- T_nigroviridis300022 -CTGCCTGATGGACACT--TGTTTATCTGAGAGAGTAT--- T_belangeri300382 -GGTCCTGATGGATTTG---CTTTTTCTGATAAAGCTG--- ***** ** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved