snOPY snoRNA Orthological Gene Database

Family: SNORD50

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300064 ----AATCTATGATG-ATCTTATCCCGAACCTGAATAC--ATGTTGAGAAAACCAA---- C_familiaris300065 ----AATCAATGATGAAACCTATCCCGAAGCTGACCAC--CTGAAGAAAAGCATA----- C_porcellus300722 ----AATCAGTGATGAAACCTATCCCGAAGCTGATTAC--CTGAAGAAAAACATG----- C_porcellus300723 ----TATCTATGATG-ATCCTATCCCGAACCTGAATTT--CTGTTGAAAAAACATT---- D_novemcinctus300359 ----TATCTGTGATG-ATCCTATCCCGAACCTGAATTT--CTGTTGAAA--AAAGT---T D_novemcinctus300360 ----GCTCAATGATGTAAC-TATCCCGAAACTGAACAC--CTGAAGAAAACAAG------ D_melanogaster300193 ACCAATATGATGATAACCTTTATCCCGAATTTGAAGCCAAATGAGACTAATTTTTTA--- E_telfairi300777 ----TATCTATGATG-ATCCTATCCCAAACCTGAACAAA-CTGTTGAAAAAAAGTTT--- E_caballus300099 ----ACACCAGGATG-ATCCTATCCCAAAACTGAATTT--CTGTTGAAAAAACTTA---- E_caballus300100 ----TATCGATGATG-ATCCTATCCCGAACCTGAATTT--CTGTTGAAAAAACTTA---- E_caballus300101 ----AATTCATGATGAAACCTATCCCGAAGCTGATTAC--CTGAAGAAAAGCATG----- E_europaeus300377 ----TATCTATGATG-ATCTTATCCCGAACCTGAATTT--CTGTTGAGAAAA-------C E_europaeus300378 ----GATCGATGATGAGGCTTACCCCGAAGCTGATATC--CTGAAGAAAAGAAAG----- F_catus300222 ----AATCCATGATG-ATCTTATCCCGAACCTGAATAT--CTGTTGAGAAAACTTA---- F_catus300223 ----TATCAATGATGAAATCTATCCCGAAGCTGACCAC--CTGAAGAAAAACATA----- G_gallus300002 ----CATCTATGATG-ATCCTATCCCGAACCTGAATTCT-TTGCTGAAAAACCTAC---- H_sapiens300532 ----TATCTGTGATG-ATCTTATCCCGAACCTGAACTT--CTGTTGAAAAAAAAAAACTT H_sapiens300533 ----AATCAATGATGAAACCTATCCCGAAGCTGATAAC--CTGAAGAAAAATAAG----- L_africana300403 ----TATCTATGATG-ATCCTATCCCGAAACTGAATTT--CTGTTGAAAAAACTTA---- M_mulatta300125 ----TATCTGTGATG-ATCTTATCCCGAACCTGAACTT--CTGTTGAAAAAAAAAA--TT M_mulatta300126 ----AATCAATGATGAAACCTATCCCGAAGCTGATAAC--CTGAAGAAAAATAAA----- M_mulatta300479 ----CATCTGTGATT-ATCCTATTTCGAATCTGAATTT--CTACTAGAAGAAAACT---T M_mulatta300628 ----AATCAATGATGAAACCTATCCCAAAGCTGATGAC--CTGAAGAAAAATACC----- M_domestica300089 ----TATTAATGATG-ATTCTATCCCGAACCTGAATTC--CTGTTGAAAAACTACAT--- M_domestica300090 ----ACTCAATGATG-AACCTATCCCGAACCTGATTTC--ATGATGAAAAAACTTAA--- M_musculus300110 ----AGTCTATGATG-ATCCTATCCCGAACCTGAATTC--CTGTTGAAAAACCATAA--- M_musculus300509 ----AGTCTATGATG-ATCCTATCCCGAACCTGAATTC--CTGTTGAAAGACCATAC--- M_musculus300705 ----AGTCTATGATG-ATCCTATCCCGAACCTGAATTC--CTGTTGAAAAACCATAC--- M_musculus300895 ----AGTCTATGATG-ATCCTATCCCGAACCTGAATTC--CTGTTGAAAAACCATAC--- M_musculus300896 ----AGTCTATGATG-ATCCTATCCCGAACCTGAATTC--CTGTTGAAAAACCATAA--- M_lucifugus300970 ----TATCTATGATG-ATCCTATCCCAAACCTGAATTT--CTGTTGAAAAAACTTAA--- O_anatinus304455 ----AATCAGTGATG-AGCATATCCCGAACCTGACTTC--TTGATGAAAACACTATT--- O_anatinus304456 ----TGTCTGTGATG-ATTCTATCCCGAACCTGAACTC--CTGTTGAAAAAAAACA---C O_cuniculus300004 ----TATCTATGATG-ATCTTATCCCGAACCTGAATTTTTCTGTTGAAAAAAAACGC--T P_troglodytes300490 ----TATCTGTGATG-ATCTTATCCCGAACCTGAACTT--CTGTTGAAAAAAAAAC--TT P_troglodytes300491 ----AATCAATGATGAAACCTATCCCGAAGCTGATAAC--CTGAAGAAAAATAAG----- P_troglodytes300653 ----AATCAATGATGAAACCTATCCCAAAGCTGATGAC--CTGAAGAAAAATACG----- P_pygmaeus300304 ----AATCAATGATGAAACCTATCCCGAAGCTGATAAC--CTGAAGAAAAATAAG----- P_pygmaeus300559 ----CATCTGTGATT-ATCCTATTTCAAACCTGAATTT--CTACTAGAA-AAAACT---T P_pygmaeus300653 ----AATCAATGATGAAACCTATCCCAAAGCTGATGAC--CTGAAGAAAAATACG----- P_pygmaeus300303 ----TATCTGTGATG-ATCTTATCCCGAACCTGAACTT--CTGTTGAAAAAAAAAC--TT R_norvegicus300630 ----AATTAATGATG-ATCCTATCCTGAATCTGAATTC--CTGTTGGAAAACCATAA--- R_norvegicus300798 ----GATCTATGATG-ATCCTATCCCGAATCTGAATTC--CTGTTGAAAAAATATAA--- R_norvegicus300778 ----GATCTATGATG-ATCCTATCCCGAATCTGAATTC--CTGTTGAAAAACTGTAG--- S_araneus300658 ----GATCAATGATGAAACCTATCCCGAAACTGATCAC--CTGAAGAAAAAAACATG--- T_belangeri300106 ----TACCTATGATG-ATCCTATCCCGAACCTGAATTT--CTGTTGAAAAAAATAAA--- T_belangeri300107 ----AATAAATGATGAAACCTATCCCGAAACTGAATAC--CTGAAGAAAAACCTG----- *** ** ** *** * * C_familiaris300064 -TACGGATCTGGCTTCTGAGAT C_familiaris300065 -TACGGATTCGGCTTCTGAGAT C_porcellus300722 -CACGGATTCGGCTTCTGAGAT C_porcellus300723 -TACGGATCTGGCTTCTGAGAT D_novemcinctus300359 ATACGGATCTGGCTTCTGAGAT D_novemcinctus300360 -TACGGATTCGGCTTCTGAGAT D_melanogaster300193 -TACTGATCGA----------- E_telfairi300777 ATATGGATCTGGCTTCTGAGTT E_caballus300099 -TACGGATCTGGCTTCTGAGAC E_caballus300100 -TACGGATCTGGCTTCTGAGAT E_caballus300101 -TGCGGATTCGGCTTCTGAGAT E_europaeus300377 GTACGGATCTGGCTTCTGAGAT E_europaeus300378 TTACGGATTCGGCTTCTGAGAT F_catus300222 -TACGGATCTGGCTTCTGAGAT F_catus300223 ---CGGATTCGGCTTCTGAGAT G_gallus300002 -TACGGATCCGGCATCTGAGAT H_sapiens300532 TTACGGATCTGGCTTCTGAGAT H_sapiens300533 -TACGGATTCGGCTTCTGAGAT L_africana300403 -TACGGATCTGGCTTCTGAGAT M_mulatta300125 TTACGGATCTGGCTTCTGAGAT M_mulatta300126 -TACGGATTCGGCTTCTGAGAT M_mulatta300479 GTATGATTCTGGCTTCTGAGAT M_mulatta300628 -TACAGATTCAGCTTCTGATAT M_domestica300089 ATACGGATCTGGCTTCTGAGAT M_domestica300090 ATACGGATCTGGCTTCTGAGAA M_musculus300110 TTACGGATCTGGCTTCTGAGAT M_musculus300509 TTACGGATCTGGCTTCTGAGAT M_musculus300705 TTACGGATCTGGCTTCTGAGAT M_musculus300895 TTACGGATCTGGCTTCTGAGAT M_musculus300896 TTACGGATCTGGCTTCTGAGAT M_lucifugus300970 -TACAGATCTCATTTTGGAGAT O_anatinus304455 ATACGGATCTGGCATCTGAGAA O_anatinus304456 AAACGGATCTGGCTTCTGAGAT O_cuniculus300004 ATACGGATCTGGCTTCTGAGAT P_troglodytes300490 TTACGGATCTGGCTTCTGAGAT P_troglodytes300491 -TACGGATTCGGCTTCTGAGAT P_troglodytes300653 -TACAGATTCAGCTTCTGAGAT P_pygmaeus300304 -TACGGATTCGGCTTCTGAGAT P_pygmaeus300559 ATATGAATCTGGCTTCTGAGAT P_pygmaeus300653 -TACAGATTCAGCTTCTGAGAT P_pygmaeus300303 TTACGGATCTGGCTTCTGAGAT R_norvegicus300630 TTACGGATCTGGCCTCTGAGAT R_norvegicus300798 TTACGGATCTGGCTTCTGAGAT R_norvegicus300778 TTACAGATCTGGCTTCTGAGAT S_araneus300658 TTACGGATTCGGCTTCTGAGAT T_belangeri300106 ATACGGATCTGGCTTCTGAGAT T_belangeri300107 -TACGGATTCGGCTTCTGAAAT *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved