snOPY snoRNA Orthological Gene Database

Family: SNORD49

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300342 ---TGCTCTGATGAA-ATCAC-------TTATAGGAAGTGCCGTCAGAAG C_porcellus300566 ---TGCTCTGATGATTACTAGTA----AT---AGGAAATGCCATCAGAAG C_porcellus300741 ---TGCTCTGATGAT-ATCAC-------TGACA----------------- C_porcellus300951 ---TGTTGTGATGATAACGA-------GTAATAGGAAGTGCCGTCAGAAG C_porcellus300952 ---TGCTCTGATGAT-ACCAC------TTAATAGGAAGTGCCGTCAGAAT D_rerio300029 ---TTCTGTGATGAAAA-CGC------TATATAGGAAGTGCCGTCTGATG D_rerio300030 ---TTCTGTGATGAAAA-CGC------TATATAGGAAGTGCCGTCTGATG D_novemcinctus300184 ---TGCTCTGATGAA-AACC-------ATAATAGGAAGTGCCGTCAGAAG D_novemcinctus300409 ---TGCTCTGATGAA-AACC-------ATAATAGGAAGTGCCGTCAGAAG D_novemcinctus300549 ---TGTTGTGATGAT-ACTG-------GTAATAGGAAGTGCCGTCAGAAG D_melanogaster300098 --TGCACATGATGATAATTTGTC-TTCTTGATAGGAAGTGCCAACTGACA D_melanogaster300099 -CTGCACATGATGATAATTGAAAGTTCTTGATAGGAATTGCCGGCTGACA E_telfairi300714 ---TGGCCTGATGATA-TTG-------GTAATAGGAAGTGCCGTCAGACG E_caballus300107 ---TGCTCTGATGAA-ATCAC-------TAATAGGAAGTGCCGTCAGAAG E_caballus300108 ---TGTCCTGATGAT-ACTG-------CTATTAGGAAGTGCCGTCAGATG E_europaeus300220 -------------AGATTGAAAGAATACTTATAGGAAGTGCTTTCAGATG E_europaeus300307 ---TGCTCTGATGAA-ATCAC-------TCATAGGAAGTGCCATCAGATG E_europaeus300526 ---TGCTCTGATGAA-ATCAC-------TCATAGGAAGTGCCGTCAGATG E_europaeus300615 ---CGTCGTGATGAC-ACCGGGAACTAATGTTAGGAAGTGCCGTCAGAGT E_europaeus300616 ---TGCTCTGATGAA-ATCAC-------TCATAGGAAGTGCCGTCAGATG F_catus300291 ---TGCTCTGATGAA-ATCAC-------TTATAGGAAGTGCCGTCAGAAG G_gallus300024 -------------------------------------------------- G_aculeatus300010 -----CGATGACGAAAA-CCT------GCAATAGGAAGTGCCGTCTGATG G_aculeatus300093 ---TTCGGTGATGATAA------------CCTAGGAAGTGCCGTCCGATG H_sapiens300703 ---TGTCCTGATGAT-ACTT-------GTAATAGGAAGTGCCGTCAGAAG H_sapiens300704 ---TGCTCTGATGAA-ATCAC-------TAATAGGAAGTGCCGTCAGAAG L_africana300512 ---TGTCCTGATGAGA-TTG-------GTAATAGGAAGTGCCGTCAGAAG M_mulatta300511 ---TGCTCTGATGAA-ATCAC-------TAATAGGAAGTGCCGTCAGAAG M_mulatta300512 ---TGCCCTGATGAT-ACTT-------GTAATAGGAAGTGCCGTCAGAAG M_murinus300550 ---TGTCCTGATGAT-ACTG-------GAAATAGGAAGTGCCGTCAGAGA M_domestica300004 ---TGGCGTGATGAGAACCC-------AGAATAGGAAGTGCCGTCAGAC- M_domestica300006 ---GTTCATGATGAT-ACCAC------TCAATAGGAAGTGCCGTCAGATG M_musculus300078 -----TGATGATGAA-ACTAGAA----AAAAAAGGAAGTGCCGTCCGATG M_musculus300079 ---TGCTGTGATGAG-ATGAC------TAAGTAGGAAGTGCCGTCAGAGT M_lucifugus300386 ---TGCTCTGATGAA-ATCAC-------CAATAGGAAGTGCCGTCAGAAG M_lucifugus300505 ---TGTCCTGATGAT-ACCG-------ATCCTAGGAAGTGCCGTCAGATG M_lucifugus300506 ---TGCTCTGATGAA-ATCAC-------CCATAGGAAGTGCCGTCAGAAG M_lucifugus300962 ---TGCTCTGATGAA-ATCAC-------CCATAGGAAGTGCCGTCAGAAG M_lucifugus300963 ---TGTCCTGATGAT-ACTG-------ATCCTAGGAAGTGCCGTCAGATG O_anatinus304457 ---CCAAATGAAGAAAA-CCG------GGGATTGGAAGTGCCGTCAAATG O_anatinus304458 ---CCAGATGATGAGAA-CCG------TGGATAGGAAGTGCCGTCAGATG O_anatinus304460 TGCAATGATGATAAC-AT-GG------AATATAGGAAGTGCCGTCAGATG O_cuniculus300147 ---TGACCTGATTAT-ATTA-------GTAATAGGAAGTGCAATAAGAAG O_cuniculus300180 ---TGGCCTGATGAC-ACCA-------GTAATAGGCTGTGCCCTCAGAAG O_cuniculus300487 ---TGACCTGATGATA-CCA-------GTAATAGGAAGTGCCGTCAGAGG O_cuniculus300488 ---TGCTGTGATGAG-ATCAC-------TCTTAGGAAGTGCCGTCAGAAG O_latipes300028 ---GTCTGTGATGAAAA-TTG------TGAATAGGAAGTGCCGTCTGATG O_latipes300030 ---TTCAATGATGAAAA-CCT------GGAATAGGAAGTGCCGTCAGATG O_garnettii300677 ---TGTCCTGATGAT-ACTA-------GTAATAGGAAGTGTCATTAGAGG O_garnettii300678 ---TGCTCTGATGAA-ATCGC-------TAATAGGAAGTGCCGTCAGAAG P_troglodytes300550 ---TGTCCTGATGAT-ACTT-------GTAATAGGAAGTGCCGTCAGAAG P_troglodytes300551 ---TGCTCTGATGAA-ATCAC-------TAATAGGAAGTGCCGTCAGAAG P_pygmaeus300771 ---TGTCCTGATGAT-ACTT-------GTAATAGGAAGTGCCGTCAGAAG P_pygmaeus300772 ---TGCTCTGATGAA-ATCAC-------TAATAGGAAGTGCCGTCAGAAG R_norvegicus300508 ---TGCACTGATGAA-ACTAGAA----AT---AGGAAGTGCCGTCCGAAA R_norvegicus300509 ---TGCTGTGATGAG-GACAC------CA-GTAGGAAGTGCCGTCAGAGT S_araneus301034 ---TGCTCTGATGAC-ACGGC------T-AATAGGAAGTGCCGTCAGAAT S_tridecemlineatus300328 ---TGCTCTGATGAA-ACCATTA----ATAATAGGAAGTGCCGTCAGAAG T_nigroviridis300055 ---GTCAATGATGAAGT-CTT------GGAGTAGGAAGTGCCGTCAGATG T_nigroviridis300057 ---GTCAATGATGAAAA-CT---------AATAGGAAGTGCCGTCTGATG T_nigroviridis300134 ---TTCCGTGATGAAAAGTGC------TACATAGGAAGTGCCGTCTGACA T_belangeri300116 ---------AATTGAAATTATT--TTTGTAATAGGAAGTGCTGTCAGAAG T_belangeri300227 ---TGCTCTGATGAA-ATCAC-------TAATAGGAAGTGCCGTCAGAAG T_belangeri300266 ---TGCTCTGATGAA-ATCAC-------TAATAGGAAGTGCCGTCAGAAG T_belangeri300328 ---AGACTGGATGAC-AGTA-------GTGTTAGGAAGTGCCGTCAGGAG X_tropicalis300064 ---AAACATGATGAA-ATCTG------GATATAGGAAGTGCCGTCAGATG X_tropicalis300065 ---GAGCATGATGAA-ACCAG------GATATAGGAAGTGCCGTCAGATG C_familiaris300342 CGATAACTGACGATAACCTTTCC-T-----GGCTGACT--- C_porcellus300566 TAATAACTGACAATATTTATACT-TG----ATCTGACT--- C_porcellus300741 --ATAACTGACAATAACTACTAC-T-----GGCTGACT--- C_porcellus300951 CGATAACTGACGATATATATTCT-TG----ATCTGATT--- C_porcellus300952 CGATAACTGACGATAACTATTCC-T-----GGCTGACC--- D_rerio300029 CGATAACTGACGATGGCAAAGCAAAATCTTT-CTGAGA--- D_rerio300030 CGATAACTGACGATGGCAAAGCAAAATCTTT-CTGAGA--- D_novemcinctus300184 CGATAACTGACGATAACTATTCT-T-----GGCTGACT--- D_novemcinctus300409 CGATAACTGACGATAACTATTCT-T-----GGCTGACT--- D_novemcinctus300549 CGATAACTGACGATGTTTTATGC-CC----GTCTGACC--- D_melanogaster300098 C-ATAAATGAAGCTAGTTTAACCCT-------CTGAAAGCA D_melanogaster300099 C-ATATATGAAGCTAATTCTAGTTTA-----TCTGATTACA E_telfairi300714 CGATAACTGACGATGTCTGTACC-TG-----CCTGACC--- E_caballus300107 CGATAACTGACGATAACAATTCC-T-----GGCTGACT--- E_caballus300108 CGATAGCTGACGAC-TTTCATGC-CT----GTCTGACC--- E_europaeus300220 GGATAACTGATGATAAT--AACTCCT-----ATTAAAAA-- E_europaeus300307 CGACAAATGTATGCACATGT-------A--TGCAC------ E_europaeus300526 CAAAAAAAAAAAAAGTATGTTGT---GA--TGTTCACT--- E_europaeus300615 CGACAAGTGACGAGACTTCAGGC-C-----CGCTGACC--- E_europaeus300616 CGACAGCTGACGAGAA-T--TCC-T-----GGCTGATG--- F_catus300291 CGATAACTGACGATAACAGTTCC-T-----GGCTGACT--- G_gallus300024 ----------------------------------------- G_aculeatus300010 CGACAACTGACGA---T-------CCACTATTCTGAGT--- G_aculeatus300093 CGATAACTGACGATGGAATG--AACTGTTAC-CTGAGG--- H_sapiens300703 CGATAACTGACGACGTCTAATGT-CT----ATCTGACC--- H_sapiens300704 CGATAACTGACGAAGACTACTCC-T-----GTCTGATT--- L_africana300512 CGATAACTGACGATATCTGCGTT-TG-----TCTGACT--- M_mulatta300511 CGATAACTGACGAAAACTACTCC-T-----GTCTGATT--- M_mulatta300512 CGATAACTGACGACGTTTAACGT-CT----ATCTGACC--- M_murinus300550 CGATAACTGACGACGTTT-ATGC-TT----GTCTGACC--- M_domestica300004 CGACAACTGACGATAGCCTGAGC-TGGT--GTCTGACC--- M_domestica300006 CGATAACTGACGATGAACTTGA--TCAT--GTCTGACA--- M_musculus300078 CGACAACTGACGACATCCCTAGT-TA----G-CTGACT--- M_musculus300079 CGATAACTGACGATAACTGCTCC-T-----GGCTGACT--- M_lucifugus300386 CGGTAACTGACGATAA---TTCC-T-----GGCTGACT--- M_lucifugus300505 CGCTAGCTGACGA--TTTCACAC-G-----ATCTGACC--- M_lucifugus300506 CGATAACTGACGATAA---TTCC-T-----GGCTGACT--- M_lucifugus300962 CAATAACTGATGATAA---TTCC-T-----GGCTGACT--- M_lucifugus300963 CGATAACTGACGA--TTTCACAC-G-----ATCTGACC--- O_anatinus304457 CTATAACTGACGA---TNNNNNNNNNNGGGA-CTGTGT--- O_anatinus304458 CGAGAACTGACGA---TGGATTTTCACGGGGTCTGACT--- O_anatinus304460 CGATAACTGACGATAATCTCTGTACCTA--ATCTGACC--- O_cuniculus300147 CAATAACTGATGATGTTT-ATGC-CC----ATCTGACT--- O_cuniculus300180 CGTTAACTGACCATGTTC-ATGT-GT----GTGTGGGG--- O_cuniculus300487 CGATAACTGACGATGCCCGTAGC-CG-----TCTGAGC--- O_cuniculus300488 CGACAACTGACGAGAA-TGCTCC-T-----GGCTGATT--- O_latipes300028 CGATAACTGACGATG-TTTCTTGATCACAGTTC-------- O_latipes300030 CGATAACTGACGAAAATTTCTAATCCGCTTTTC-------- O_garnettii300677 CGGTAACAGACGACGTTT-ATGC-CT----GTCTGACT--- O_garnettii300678 CGATAACTGACGATAACTATTAC-T-----GTCTGACT--- P_troglodytes300550 CGATAACTGACGACGTCTAATGT-CT----ATCTGACC--- P_troglodytes300551 CGATAACTGACGAAGACTACTCC-T-----GTCTGATT--- P_pygmaeus300771 CGATAACTGACGACGTCTAACGT-CT----ATCTGACC--- P_pygmaeus300772 CGATAACTGACGAAGACTACTCC-T-----GTCTGATT--- R_norvegicus300508 CGACAACTGACGACATCTCTATT-TA----G-CTGACT--- R_norvegicus300509 CGATAACTGACGATAACTTCTCC-CC----GACTGACT--- S_araneus301034 CGATAACTGACGACGAGAAGCCT-G-----GGCTGACT--- S_tridecemlineatus300328 CGATAACTGACGATAACTATTCC-T-----GGCTGACT--- T_nigroviridis300055 CGACAACTGACGA---TTTCTGATCCACTTTTTTGAGG--- T_nigroviridis300057 CGATAACTGACGATG-TTTAATATTCACCGTTC-------- T_nigroviridis300134 CGATAACTGACGATGGCCAA--AGCTGTT---CTGAGA--- T_belangeri300116 CGATAACTGACGATAGCT-ACTCCTG-----GCTGATG--- T_belangeri300227 CGATAACTGACAATAACTACTCC-T-----GGCTGATT--- T_belangeri300266 CGATAACTGACGATAACTACTCC-T-----GGCTGATG--- T_belangeri300328 CGGAAACTGAC---GTTT-ATGC-TT----TTCTGATC--- X_tropicalis300064 CGATAACTGACGAGAACCTTTT--CCTG--TTCTGACT--- X_tropicalis300065 CGATAACTGACGAGAACCTTTT--CCTG--TTCTGACT---

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved