snOPY snoRNA Orthological Gene Database

Family: SNORD49

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300368 --TACCCCCTTTTCA-CTTTGC-CAATTGGACTT-----ATGTCTTTATT C_porcellus300048 --AAAGCCCCTTTCA-CTTTGC-CAGTGGGAC----TTAATGTCTTCATT C_porcellus300176 --ACACCCTCTGTCA-CTTTGC--CAGTGGAC----TTA-CATGTTTATT D_novemcinctus300405 ---TGCTCGCTTTCCACATTGC-CAGTTGGACAT-----ATGTCTTTATT D_novemcinctus300419 --TTCTCACTTTTCA-CATAGC-CAATTGCA--C-----ATGTCTTTATT E_telfairi300188 --CTCCCCCTACTCA-TTTTGT-GAATTGGAC----TT-AGGTCTTTACC E_telfairi300321 --CACCCCCTTTTCA-CTTTGC-CAATTGGAC----TT-ATGTCTTTATT E_telfairi300403 --CACCCCCTTTTCA-CGTTGC-TAATTGGACTT-----ATGTCTTTATT E_telfairi300561 --CACCCCCTTTTCA-CTTTGC-CAATTGGAC----TT-ATGTCTTTATT E_telfairi300646 ---CCCCCTTTTTCACTTTTGC-CAATTGGAC----TTTATGTCTTTATT E_caballus300351 --TACCCCCTTTTCA-CTTTGC-CAATTGGACTT-----ATGTCTTTATT E_europaeus300079 --CAGCCCCATCTCA-ATTTTC-AAATTGGAC----TT-GGGCCTTTATT E_europaeus300080 --GTTCCCCCTTTTA-CTTTGC-CAATTGGACTT-----ATGTCTTTATT E_europaeus300319 --TTTTCCCCTTTCA-CTTTGC-CAATTGGACT-------TGTCTTTATT F_catus300245 --TACCCCCGTTTCA-CTTTGC-CAATTGGACTT-----ATGTCTTTATT G_gallus300030 --CACCCTCCTTTCA-CTTTGC-CAGTTAGACACTT-TTTTGTCTTGATT H_sapiens300598 --TACCCCCTTTTCA-CTTTGC-CAGTTGGACTT-----ATGTCTTTATT L_africana300436 --TACCCGCTTTTCA-CTTTGC-CAATTGGACTT-----ATGTCTTTATT M_mulatta300008 --AACCCCCTATTCA-CTTTGC-CAATTGGACTT-----ATGTCTTTATT M_mulatta300025 --AACCCCCTGTTCA-CTTTTT-AAAATGGA-----TTTATGTCTTTATT M_mulatta300380 --TACCCTCTTTTTA-CTCTGC-CAACTGGATGT-----ATATAATTACT M_mulatta300737 --TACCCCCTTTTCA-CTTTGC-CAATTGGACTT-----ATGTCTTTATT M_murinus300008 --AAACCCCTTTTCA-CTTTGC-CAATCGGACTT-----ATGTCTTTATT M_murinus300074 --TGACCTCTTTTCA-CTTTGT-CAGTTGGA-----TTTATGTCTTTATT M_murinus300262 --------TAATTAAGGATCAC-TAATTGGACTT-----ATGTCTTTATT M_murinus300366 --GACCCCATTTTCA-TTTTGC-CAATTGGACTT-----ATGTCTTTATT M_murinus300425 --TACCCCCTTTTCA-CTTTGC-CAATCGGACTT-----ATGTCTTTATT M_domestica300154 --CTCCCCTCTTTCA-CTTTAC-CAATTAGACACA--TCATGTCTTTATT M_musculus300779 --ACCCCCCCTTTCA-CTTTGC-CAATTGGAC----TTAATGTCTTCATT O_anatinus303878 --TCCCCCCCTTTCA-CTTTGC-CAGTTAGACATTTCTCTTGTCTTTATT O_cuniculus300244 --CATCCCCTTTTCT-CTTTGC-CAATTGAACC---TTTATATCTTTATT O_cuniculus300392 --TTTCCCCTTTTTA-CTTTGC-TAGCTGGAC----TTA-TGTCTTCATT O_cuniculus300414 --CGCCCCCTTTTCA-CTTTGC-CAATTTGACT---TTTTTGTCTTTATT O_garnettii300135 --TGCCCCCTTTTTA-CTTTGC-CAGTTAGACTT-----ATGTCTTTATT O_garnettii300294 --TGCCCCCCTTTCA-CTTTGC-CAATTGGACTT-----ATGTCTTTATT O_garnettii300324 --GCCCCCCTTTTCA-CTTTGC-CAGTTGGACTT-----ATGTCTTTATT O_garnettii300449 -GTGCCTC-CTTTCA-CTTTAC-CGATTGGAC----TTA-GATCTTTATT O_garnettii300531 --GCCCCCCTTTTCA-CTTTGC-CAGTTGGACTT-----ATGTCTTTATT O_garnettii300597 --TGCCCCCTTTTCA-CTTTGC-CAGTTGGACTT-----ATGTCTTTATT O_garnettii300724 --TGCCCCCTTTGCA-CTTTGC-CAATTGGACTT-----ATGCCTTAATT O_garnettii300725 --TATCCCCTTTTCA-CTTTGC-CAGTTGGACTT-----ATGTCTTTGTT P_troglodytes300148 --TACCCTCTTTCCA-CTTTGC-CAACTGGATGG-----ATGTCTTTACT P_troglodytes300351 --AAACCCCTGTTCA-CTTTGC-CAAATGGA-----TTTGTGTCTTTATT P_troglodytes300382 --AACCCCCTTTTCA-CTTTGC-CAATTGGACTT-----ATGTCTTTATT P_troglodytes300738 --TACCCCCTTTTCA-CTTTGC-CAGTTGGACTT-----ATGTCTTTATT P_pygmaeus300068 --TACCCTCTTTCCA-CTTTGC-CAACTGGATGT-----ATGTCTTTACT P_pygmaeus300209 --AACCCCCTTTTCA-CTTTGC-CAATTGGACTT-----ATGTCTTTATT P_pygmaeus300310 --AAACCCCTGTTCA-CTTTGC-CAAATGGA-----TTTGTGTCTTTATT P_pygmaeus300545 --AACCCCCTTTTCA-CTTTGC-CAATTGGACTT-----ATGTCTTTATT P_pygmaeus300713 --TGCCCCCTTTTCA-CTTTGC-CAGTTGGACTT-----ATGTCTTTATT R_norvegicus301019 --ACACCCCCTTTCA-CTTTGC-CAATTGGAC----TTAATGTCTTCATT S_araneus300059 --TGCCCCTTTCTCA-CTTTGC-CAAGTGGACTT-----ATGTCTTAACT S_araneus300086 --CCCCCCCTTTTCA-CTTTAC-CCACCGGACT-------CATCTTTATT S_araneus300504 --TACTCCCTTCGCA-TTTTGC-CTATTTGAGTT-----ATGTCTTTATT S_araneus300589 --TGCCCACTTCTCA-CTATGT-TAATTGGATTT-----GTGTCTTTACA S_araneus300590 --TGCCCCTGTCTCA-CTTTCC-CAATTGGATTT-----ATGTCTTTATT S_araneus300630 ATGGCCCCGC--TCG-CTTAGC-AAACTGAACTT-----ATGTCTTTAGT S_araneus300650 --TGCCCCCTTCTCA-CTTTGC-CAATTGGACTT-----ATGTCTTAATT S_araneus300700 -ATGCCTC-TTCTCA-CTTTGT-CAATTGCACTT-----ATGTCTTAATT S_araneus300723 --TGTCCCCTACTTC-CTTTGC-CAATTCGAC-----TTATGTCTTAATT S_araneus300808 --TGCATCCTTCTCA-TATTGC-TGACTAGACTC-----AAGTTTTCATT S_araneus300889 -----------ATCA-TGAGAT-TTAATTTATAC-----ATAAAAAT-CT S_araneus300912 --TGCCCCCTTCTCA-TTTTGC-CAATTGGACT------ATGTCTTAATT S_araneus301026 --TGCACCCTTCTCA---CTGC-CAGTTGGACTT-----AA-TCTTAGTT S_tridecemlineatus300172 --TGTCTCTCTTTCA-CTTTGCTCAAATGGAC----TGA-TGTCTTTATT T_nigroviridis300051 --GGCCCCACCTTCA-CTTTGC-CACCAGGGCTGT--TGATGTCGTGAGT T_belangeri300073 --CACCCCCTTTTCT-CTTTGC-CAGTTGGACTT-----ATGTCTTTATT T_belangeri300190 --AACCCCCTTTTCA-CTTTGC-CAGTTAGACTT-----ATGTCTTTATT C_familiaris300368 GGTCATTCAAGTGGGG-CAAATGAAAT-ATCC-TTTTAAAACTCAAG-CA C_porcellus300048 GGTCATTCAAGTGGGG-CAAAGGAAATATCCT-T-TTAAAACTCTGG-CA C_porcellus300176 AGTCATTCAAGTGGAG-CAAAGGAAATATCTT-T-TTAAAATTCAGG-CA D_novemcinctus300405 GGTCATTCAGTTTGGG-CAAAAGAAACAGCC--TTTTAAAGCTCAGG-CA D_novemcinctus300419 GGTCATTCAAGTGGAG-CAAAGGAAACATCGT--TTTAAAACTCAGG-TG E_telfairi300188 AGTCATTCAAGTAGGG-CAAAAGAAACATTC--TTTTAAAG-TCAGG-CA E_telfairi300321 GGTCATTCAAGTGGGG-CAAAAGAAATATCC--TTTTAAAACTCAGG-CA E_telfairi300403 GGTCATTCAAGAGGAG-CAAAATAAATATCATGGGTGTTTGTCTTGG-CA E_telfairi300561 GGTCATTCAAGTGGGG-CAAAAGAAGTATCC--TTTTCAAACTCAGA-CA E_telfairi300646 GGTCATTCAAGTGGGGGCAAAAGAAACATCCC-TTTTAAAACTCAGGGCA E_caballus300351 GGTCATTCAGGTGGGG-GAAAGGAAAAGATCC-TTTTAAAACTCAAG-CA E_europaeus300079 GGTCATTCAAACGGGG-CAAAAGAAATACCC--TTTTAAAACTCAGG-CA E_europaeus300080 GGTCATTCAACTGGGG-CAAACGAACTACCC--TTTTAAAACTCAGG-CA E_europaeus300319 GGTCATTCAAGTGAGG-CAAAGGAAATACCC--TTTTAAAACTCAGG-CA F_catus300245 GGTCATTCAAGTGGGG-CAAAGGAAAT-ATCC-TTTCAAAACTCAAG-CA G_gallus300030 GGTCATTCAAGGTGGG-TAAAGTATACATCC--TTTTAAAACCCAAG-CA H_sapiens300598 GGTCATTCAAGTGGGG-CAAAGGAAATA-TCC-TTTTAAAACTCAGG-CA L_africana300436 GGTCATTCAAGTGGGG-TAAAGGAAATA-TCC-TTTTAAAACTCAGG-CA M_mulatta300008 GATCATTCAAGTGGG--CAAAGGAAATA-TGC-TTCAAAAACTCAGG-CA M_mulatta300025 GCTCATT-AATTGGGG-CAAAGGAAATATCCT-T-TTAAAACTCAGG-CA M_mulatta300380 GGTCATTCCAGTGGGG-CAAAGGAAATATCCT-TTTTAAAACTCAGG-TA M_mulatta300737 GGTCATTCAAGTGGGG-CAAAGGAAATAATCC-TTTTAAAACTCAGG-CA M_murinus300008 GGTCATTCAAGTGGGG-CAAAGGAAATA-TCC-TTTTAAAACTCAGG-CA M_murinus300074 AGTCATTCAAGCGTGG-CAAAGGAAGTACCCT-T-TTAAAACTCAGG-CA M_murinus300262 GGTCATTCAAGTGGGG-CAAAGGAAATATCC--TTTTAAAGCTCAGG-CA M_murinus300366 GGTCATTCAAGTGGGG-CAAAGGACACA-TCC-ATTTAAAACTCAGG-CA M_murinus300425 GGTCATTCAAGTGGGG-CAAAGGAAATA-TCC-TTTTAAAACTCAGG-CA M_domestica300154 GGTCATTCAAGTGGGG-TAGAAGAAATATCC--TTTTAAAACTCAAG-CA M_musculus300779 GGCCATTCAAGTGGGG-CAAAGGAAATAACCT-T-TTAAAACTCAGG-CA O_anatinus303878 GGTCATTCAAATGGGG-TAAATTAATT-TCC--TTTTAAAACTCAAG-CA O_cuniculus300244 GGTCATTCAATTGGGG-CAAAGGAACTATCCT-T-TTAATATTCAGG-CA O_cuniculus300392 GGCCATTCAAGATGGG-CAGAGGAAATATTAT-T-TTAAGATTCAGG-CA O_cuniculus300414 GGTCATTCAAGTGGGG-CAAAGGAACTATCCT-T-TTAAAACTCAAG-CA O_garnettii300135 GGTCATGTAAGTGGGG-CAAAGCAAATA-TCC-TTTCAAAACTCAGG-CA O_garnettii300294 GGTCATTTAAGTAGGG-CCAAGCAAATA-TCC-TTTTAAAATTCAGG-CA O_garnettii300324 GGTCATTCAAGTGGGG-CAAAGAAAATA-TCC-TTTTAAAACTCAGG-CA O_garnettii300449 GGTCATTCAA-TGGG---AAAGGAAATGTT-----TTAAAACTTAGG-CT O_garnettii300531 GGTCATTCAAGTGGGG-CAAAGAAAATA-TCC-TTTTAAAACTCAGG-CA O_garnettii300597 GGTCATTCAAGTGGGG-CAAAGGAAATA-TCC-TTTTAAAACTCAGG-CA O_garnettii300724 GGTG--------GGGG-CAAAGGAAATA-TCC-TTTTAAAACTCAGG-CA O_garnettii300725 GGTCACTCAAGTGGGG-CCAAGGAAATA-TCC-TTTTAAAATGCAGG-CA P_troglodytes300148 GGTCATTCCAGTGGGG-CAAATGAAATATCCT-TTTTAAAACTCAGG-CA P_troglodytes300351 GCTCATT-AATTGGGG-CAAAGGAAATATCCT-T-TTAAAACTCAGG-CA P_troglodytes300382 GATCATTCAAGTGAG--CAAAGGAAATA-CGC-TTTAAAAACTCAGG-CA P_troglodytes300738 GGTCATTCAAGTGGGG-CAAAGGAAATA-TCC-TTTTAAAACTCAGG-CA P_pygmaeus300068 GGTCATTCCAGTGGGG-CAAAGGAAATATCCT-TTTTAAAACTCAGG-CA P_pygmaeus300209 GATCATTCAAGTGAG--CAAAGGAAATAACGC-TTTAAAAACTCAAG-CA P_pygmaeus300310 GCTCATT-AATTGGGG-CAAAGGAAATATCCT-T-TTAAAACTCAGG-CA P_pygmaeus300545 GATCATTCAAGTGAG--CAAAGGAAATA-CGC-TTTAAAAACTCAGG-CA P_pygmaeus300713 GGTCATTCAAGTGGGG-CAAAGGAAATA-TCC-TTTTAAAACTCAGG-CA R_norvegicus301019 GGCCATTCAAGTGGGG-CAAAGGAAATAACCT-T-TTAAAACTCAGG-CA S_araneus300059 GCCCATTCA--TGGGG-CAAAGGAAGCC-TC--CTTGAAAACTCAAG-CA S_araneus300086 GGCCATTCAAGTGGAG-CAAAGGAA-TAACC--TTTTAAAACTCAAG-CA S_araneus300504 GGTTACTCAAGTGGAG-CAGGGGAAATATCCT--TTTATAATTTAAG-CA S_araneus300589 GATCATTCAAGTGGGG-CAAAGGAAATATTAT--ATTAACACTCAAC-CA S_araneus300590 GGTCATTCAAGTGGGG-CAAAGGAAGTGTCC--TTTTAAAACTCAAG-CA S_araneus300630 AGCCATTCATGTGGGG-CAAAGGAAGTGCTC--TGTCCAAACTCAAG--- S_araneus300650 G-TCATTCAAGTGGAG-CAAAGGAAGTGTCC--TTCTAAAACTCAGG-CA S_araneus300700 GGTCATTCAAGTGGGG-CAAAGGAAGTGCCC--TTTTAAA-CTCAAG-CA S_araneus300723 GGTCACTCAAGTGGGG-CGAACGAAGTGTTC--TTTTAAAATTCAAG-CA S_araneus300808 GGTAATTCTAGTGAGG-CAAAGGAAGTGTCC--TTTTAAAATTGAAG-CA S_araneus300889 CTGCATTCAAGTGGGG-TAAAGGGCATGTCCT-TTT-AAAACTCAAG-CA S_araneus300912 GGTCATACAAGTGGGA-CAAAGGAAGCGTCC--TTTTAAAACTCAAG-CA S_araneus301026 GGTCATTCAAATAGGG-CAAAGTAAG-GTCC--TTTTAAAACTCAAG-CA S_tridecemlineatus300172 GGTCATTCAAGTGGGG-CAAAGGAAATGTTCT-TCTTAAAACTCAGG-CA T_nigroviridis300051 GGTCATTCGTGTGGGG-AAAAGCATTTCATC--CTCGAACACCCCAG-TC T_belangeri300073 GGCCATTCAAATGGGG-CAAAGGAAATG-TCC-TTTTAAAACTCAAG-CA T_belangeri300190 GGCCATTCAA-TGGGA-CAAAGGAAATG-TCC-TTTGAAAACTCAGG-CA C_familiaris300368 AACTG--GGTGTTTG------CCTTGT--ATCCTGTCAGAGG-AAACAAA C_porcellus300048 AACT---AGTGTTTG------TCCTGT--AACCTGTCAGAG-GGAACAGT C_porcellus300176 AATT--GAGTGCTT----------TGG--AAACTTTCAGAG-GAAATAAA D_novemcinctus300405 AACTA--AATGTTTG------TCTTGT--ATCTTTTCAGAG-GAATCCAA D_novemcinctus300419 AAC------TGTTTG------TCTTAT--ATCCTGTCAG---GAAACAAA E_telfairi300188 AGCTG--GGTGTTTG------TCCAGAGGAAAGAGGTGGAG-GAAACACA E_telfairi300321 AACTG--GGTGTTTG------TCTTGG--ATCCTGTCAGAG-GAAACAGG E_telfairi300403 AACTG--GGTGTTTG------TCTTGG--CTCCTGTCAGAA-GAGACAAC E_telfairi300561 AACTG--AGTATTTG------GCTTGG--ATCCTGTCAGGG-GAAACAGG E_telfairi300646 AACTG--GGTGTTTG------TCTTGG--ATCCTGTCAGAG-GAAACAGG E_caballus300351 AACTG--AGTGTTTG------TCTTGT--ATCCTGTCAGAGG-AAACAAA E_europaeus300079 AACT----GTGTTTG------TCTTGT---ACCAGAGGAAA-TAAAC--- E_europaeus300080 AACTG--GGTGTTTG------TCTTAT--ATCCTGTCAGAG-GAAACAAA E_europaeus300319 AACTG--GGTGTTTG------TCTTGT--ATCCTGTCAGAG-GAAACAAA F_catus300245 AACTG--GGTGTTTG------TCTTGT--ATCCTGTCAGAGG-AAACAAA G_gallus300030 AATGGTGGTCATTTG------TCTTGG--ATCCTGTCAGAG-GAAACAGG H_sapiens300598 AACTG--GGTGTTTG------TCT-GT--ATCCTGTCAGAGG-AAACAAA L_africana300436 AACTA--GGTGTTTG------TCTTGT--ATCCTGTCAGAGG-AAACAAG M_mulatta300008 AACTG--GGTGTTTG------TCTTGTA-T-CCTGTCAGAGGAAG-CAAA M_mulatta300025 AACT--GAGTGTTTG------TCTTGT--ATCCTGTCAGAG-GAAAGAAA M_mulatta300380 AACTT--GATGTTTGTCATAGTCATGT--ATCCTGTCAGAG-AAAACAAA M_mulatta300737 AACTG--AGTGTTTG------TCTTGT--ATCCTGTCAGAGG-AAACAAA M_murinus300008 AACT---GGTGTTTG------TCTTGT--ATCCTGTCAACGG-AAACAAA M_murinus300074 CACG--GAGTATTTG------TCTTGT--ATCTGGTCAGTG-GAAACAAA M_murinus300262 AACTA--G-TGTTTG------TCTTAT--ATCCTGTCAAAG-GAAACAAA M_murinus300366 AACT---GGTGTTTG------TCTTGT--ATCCTGTCAAAGG-AAACAAA M_murinus300425 AACT---GGTGTTTG------TCTTGT--ATCCTGTCAAAGG-AAACAAA M_domestica300154 AACTG-GTT-GTTTG------TCTTGC--ATCCTGTCAGAG-GAAACAAT M_musculus300779 AACTT-AAGTGTTTG------TCTTGT--AACCTGTCAGGG-GAAACATT O_anatinus303878 AACAA-ATTTGTTTG------TCTTGT--ATCCTATCAGGG-GAGACATT O_cuniculus300244 AACT--GAGTGT----------CTTGT--AAC-TGTCAGAG-GAAAAAAA O_cuniculus300392 AACT--GGGTGTCTG------TCTTGT--AATCTGTCAGAG-GAAATAAA O_cuniculus300414 AGCT--GAGTGTTTG------TCTTGT--AACCTGTCAGAG-GAAACAAA O_garnettii300135 AACT---GGTGTTTG------TCTTGA--ATCTTGTCAAAGG-AAACAAA O_garnettii300294 AAAT---GGTGTTTG------TTTTGGT-ACCTTGTCAAAGGGAAACAAA O_garnettii300324 AACT---GGTGTTTG------TCTTGT--ATCCTATCAAAGG-AAAAAAA O_garnettii300449 AACT--G-GTGTTTA------TCTTGT--A-TCTGTCATAG-GAAATAAA O_garnettii300531 AACT---GGTGTTTG------TCTTGT--ATCCTATCAAAGG-AAAAAAA O_garnettii300597 AACT---GGTGTTTG------TCTTGT--ATCCTGTCAAAGG-AAACAAA O_garnettii300724 AACT---GGTGTTTG------TCTTGT--ATCCTGTCAAAGG-AAACAAA O_garnettii300725 AACT---GGT----G------TCTTGT--ATCCTGTCAAAGG-AAACAAA P_troglodytes300148 AACTG--GGTGTTTGTCATGGTCATGT--ATCATGTCAGAG-AAAACAAA P_troglodytes300351 AACT--GAGTGTTTG------TCTTGT--ATCCTGTCAGAG-GAAAGAAA P_troglodytes300382 AAC-G--G-TGTTTG------TCTTGTA-T-CCTGTCAGAGGAAA-CAAA P_troglodytes300738 AACTG--GGTGTTTG------TCT-GT--ATCCTGTCAGAGG-AAACAAA P_pygmaeus300068 AACTG--GGTGTTTGTCATGGTCATGT--ATCCTGTCAGAG-AAAACAAA P_pygmaeus300209 AAC-G--GGTGTTTG------TCTTGTA-TTCCCATCAGAGGAAAACAAA P_pygmaeus300310 AACT--GAGTGTTTG------TCTTAT--ATCCTGTCAGAG-GAAAGAAA P_pygmaeus300545 AAC-G--G-TGTTTG------TCTTGTA-T-CCCATCAGAGGAAA-CAAA P_pygmaeus300713 AACTG--GGTGTTTG------TCT-GT--ATCCTGTCAGAGG-AAACAAA R_norvegicus301019 AACTT-AAGTGTTTG------TCTTGT--AACCTGTCAGGG-GAAACATT S_araneus300059 AACTG--GGGGTTTG------TCTTGT--ATCCTGTCAGAG-GAAACAAG S_araneus300086 AAATG--GGTGTCTG------TCTTGT--ATCC----AGAG-GAAACAAA S_araneus300504 AACAA---GTGTTTG------TCTTAT--ATCTTTTCAGAG-GAAACAAT S_araneus300589 AATAT--TGTGTTTA------TCTTGG--ATCCTGTCAGAA-TAAACAAC S_araneus300590 AACTG--GGAATTTG------TCTTAC--ATCTAGTCAGAG-GAAACAAT S_araneus300630 AA--A--ACTATGTG------TTTAGA--ACCTGTCAT-AG-GGAGTAAC S_araneus300650 AACTG--GACATTTA------TCTTGT--ATTTTGTCAGGG-AAAACATC S_araneus300700 AACTG--GGTGTTTA------TCTTGT--ATAATGTCAGAG-AAAACAAC S_araneus300723 AAC----------TG------TCTTGA--ATCCTCTCAGGG-GAAAAATA S_araneus300808 AACTG--GG-GTTTG------ACTTAT--GTGCTGTCAAAA-GAAACAAT S_araneus300889 GACTG--GATGTTTGT------CTTGT--ATCCTGTCAGAG-GAAACAAC S_araneus300912 AACTG--GATGATTG------TCTTAT--ATCCTGTCTGAG-GAAATAAT S_araneus301026 AATTG--GA-GTTTG------TCTTTT--ATACTGTCAGAG-GAAACAGC S_tridecemlineatus300172 GATG--AAGTGTTTGC-----TCACGT--AACCTGTCAGATTGAAGTAGA T_nigroviridis300051 AA--A--CCCGTTTG------TTCTGG--GTCTGTCCCGAG-GAAACAGC T_belangeri300073 AACCA--GGTGTTTG------TCTTGT--ATCCTGTCAAAGG-AAACAAA T_belangeri300190 AACTA--GGAGTTTC------TCTTGT--ATCCTGTCAAAGG-AAACAAA C_familiaris300368 T C_porcellus300048 C C_porcellus300176 T D_novemcinctus300405 T D_novemcinctus300419 C E_telfairi300188 A E_telfairi300321 T E_telfairi300403 T E_telfairi300561 T E_telfairi300646 T E_caballus300351 T E_europaeus300079 - E_europaeus300080 A E_europaeus300319 A F_catus300245 T G_gallus300030 T H_sapiens300598 T L_africana300436 T M_mulatta300008 T M_mulatta300025 T M_mulatta300380 C M_mulatta300737 T M_murinus300008 T M_murinus300074 T M_murinus300262 T M_murinus300366 T M_murinus300425 T M_domestica300154 C M_musculus300779 A O_anatinus303878 T O_cuniculus300244 A O_cuniculus300392 T O_cuniculus300414 C O_garnettii300135 T O_garnettii300294 - O_garnettii300324 T O_garnettii300449 T O_garnettii300531 T O_garnettii300597 T O_garnettii300724 T O_garnettii300725 T P_troglodytes300148 C P_troglodytes300351 T P_troglodytes300382 T P_troglodytes300738 T P_pygmaeus300068 C P_pygmaeus300209 - P_pygmaeus300310 C P_pygmaeus300545 T P_pygmaeus300713 T R_norvegicus301019 G S_araneus300059 T S_araneus300086 A S_araneus300504 A S_araneus300589 T S_araneus300590 A S_araneus300630 A S_araneus300650 G S_araneus300700 G S_araneus300723 T S_araneus300808 G S_araneus300889 T S_araneus300912 G S_araneus301026 A S_tridecemlineatus300172 T T_nigroviridis300051 A T_belangeri300073 T T_belangeri300190 T

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved