snOPY snoRNA Orthological Gene Database

Family: SNORD49

CLUSTAL 2.0.10 multiple sequence alignment D_rerio300075 -GCATCAGTGAGGTTTATCCTTACCTGTTGTCTTAAAAATAAGACTA--CAGCACATGAT D_rerio300076 -ACATCAGTGAGGTTTGTCCT-ACCTGTTGTTTTAGAAATAAGACTT--TAGCACATGAT D_rerio300078 -GTATCAGTGAGGTTTATCCTTACCTGTTGTCTTAGAAATAAGACTG--CAGTATATGAT D_rerio300080 -GCATCAGTGAGGTTTATCCTTGCCTGTTGTCTTAGAATTAAGACTT--CAGCACATGAT D_rerio300082 -ACATCAGTGAGGTACATCCTTACCTGTTACCTTAGCAATAAGGTTA--CAGATCATGAT H_sapiens300518 -TAGTCAGGCGGGATAATCCTTACCTGTGCCTCCTTTTGGAGGGCAG--CAGAATGTGGT H_sapiens300693 -TCATCAGATGGGATAACTTTTACCTGTTCCTCCTTTTGGAGGTTAGATTCTAATACGAT H_sapiens300702 ATCGTCAGGTGGGATAATCCTTACCTGTTCCTCCTCC-GGAGGGCAGATTAGAACATGAT **** ** * ***** * * * * D_rerio300075 GATTGGATTCTATG-AATACGTGATTATATTCTGTATTCTTAAAGGGTTTGCAACACCTT D_rerio300076 GATTGGATTCTATG-AATATGTGATTATATTCTGTATTCGTATAGGGTTCACAACTCA-- D_rerio300078 GACTGGATTCTATG-AATATGTGATTATGTTCTGTATTTGTACATGACTTGCAACCCCTT D_rerio300080 GATTGGATTCTATG-AATACATGATTATACTCTGTATTCATATAGGGCTTGTCACCCATT D_rerio300082 GATTGGATTCTATG-AATACGTGATTATATACCGTATTTGTTTAGGGACTGCAACCCCTT H_sapiens300518 AGTTGGAGTT-GCATGATACTTGATTCATATCTCTGTGTAATGATGGCATGCAATACCCT H_sapiens300693 GATTGAAGTTCGTATGATACGTGATTAATGTCTCTGCATAATCAGGACTTGTAACACCTT H_sapiens300702 GATTGGAGAT-GCATGAAACGTGATTAACGTCTCTGCGTAATCAGGACTTGCAACACCCT ** * * * ***** * * * * * * D_rerio300075 TATGAATCCTGTCTGAC- D_rerio300076 ---GGATCCTATGTGAT- D_rerio300078 TATAAATCCTATCTGAT- D_rerio300080 TATGAATCCTGTCTGAT- D_rerio300082 TACGAATCCTGTCTGAC- H_sapiens300518 GACTGCTCCTTTCGAAT- H_sapiens300693 GATTGCTTCTGAT----- H_sapiens300702 GATTGCTCCTGTCTGATT * **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved