snOPY snoRNA Orthological Gene Database

Family: SNORD48

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300224 ---AGTGATGATGAACCCCGGTGACTCT-G--AGTG-TCTCGCTGACGCC E_telfairi300234 ---GGTGGTGATGACCCCCGGTGATTCT-G--AGTGTCTTTGCTGATGCC E_telfairi300344 ---GAGGATGATGACCCCAGGTGATTCT-G--AGTGTCTTTGCTGATG-C E_telfairi300685 --CGAGGATGATGACCCCAGGTGATTCT-G--AGTGACTTTGCTGACG-C E_caballus300005 ---GACAATGATGACTCCAGGTGACTCT-G--AGTG-TGTCGTTGACGAC E_europaeus300568 ---GATGATGACGACCCCAGGTGAATCT-G--AGTG-TTTCGCTGACGCC F_catus300069 ---GGTAATGATGAACCCAGGTGATTCT-G--AGTGTCT-CGCTGACGCC H_sapiens300528 ---AGTGATGATGACCCCAGGTAACTCTTG--AGTG-TGTCGCTGATGCC L_africana300453 ----TGATTGATGACCCCAGGTGATTCT-G--AGTG-TCTCGCTGACGCC M_mulatta300239 ---AGTGATGATGACCCCAGGTGACTCT-G--AGTG-TGTCGCTGACGCC M_murinus300260 ---GGTGATGATGACCCCAGGTGATTGAGATTGGTATCTC-ACTGATGCC M_murinus300519 ---GGTGATGACGACTTCAGGTGA--CT-G--AGTG-TCTCGCTGATGCC M_domestica300054 AGGCATGATGACCTCAGTGGAT----CT-G--AGTA-TCTCGTTGATGCT M_musculus300616 ---AGTAATGATGATTTCTGGTGATTCT-G--AGTGTCT-CGCTGACGCC O_cuniculus300042 ---GGTGAAGATAACTTTAGGTGGCTCTGA---GTGTCTC-ACTGACACC O_cuniculus300407 ---GTTGATGATGACCCCAGGTGACTCT-G--AGTG-TCTCGCTGACGCC O_garnettii300624 GGGCATGATGACCACCCCGGGTGA--CT-G--AGTG-TCTCGCTGATGCC P_troglodytes300487 ---AGTGATGATGACCCTAGGTAACTCT-G--AGTG-TGTCGCTGATGCC P_pygmaeus300702 ---AGTGATGATGACCCCCGGTGACTCT-G--AGTG-TGTCGCTGATGCC R_norvegicus300414 ---GGTAATGATGACTTCTGGTGATTCT-G--AGTGTCTTCGCTGACGCC S_araneus300713 ---GGTGATGATGAGCCCTGGTGATTCTTG--AGTGTCTT-GCTGAGGCC S_araneus300943 ---GGTGATGATGA-CCCAGGTGACTCT-G--AGTG-TCTCGCTGACGCC S_tridecemlineatus300252 ---GGTAATGATGACTCCAGGTGATTCT-G--AGCG-TGTCGCTGATGCC T_belangeri300405 ---GCTGATGATGACCCCAGGTGATTCT-G--AGTG-TCTCGCTGACGCC ** * * * *** C_familiaris300224 A-TCACCGCAGCGCGCTGACC E_telfairi300234 AT-CAC-GCAGCACTCTGACA E_telfairi300344 A-TCACCGCAGCACGCTGAC- E_telfairi300685 A-TCACCGCAGCGCGCTGACG E_caballus300005 A-TCACCGCAGCGCGCTGACC E_europaeus300568 ATTCACCGCAGCGCGCTGACT F_catus300069 G-TCACCGCAGCGCGCTGACC H_sapiens300528 A-TCACCGCAGCGCTCTGACC L_africana300453 A-TCACCGCAGCGCGCTGACA M_mulatta300239 A-TCACCGCAGCGCTCTGACC M_murinus300260 AAGCGCTGCAGCATGCTGACC M_murinus300519 AACCACCGCAGCGCGCTGACC M_domestica300054 A-CCACCGCAGCGCGCTGACT M_musculus300616 A-TCACCGCAGCGCGCTGACC O_cuniculus300042 AT-CACTGCAGCATGCTGACC O_cuniculus300407 AG-CACCGCAGCGCGCTGAC- O_garnettii300624 AATCACCGCAGCGCGCTGACC P_troglodytes300487 A-TCACCGCAGCGCTCTGACC P_pygmaeus300702 A-TCACCGCAGCGCTCTGACC R_norvegicus300414 A-TCACCGCAGCGCGCTGACC S_araneus300713 AT-CACTGCAGTA-TCTGATC S_araneus300943 A-TCACCGCAGCGCGCTGACC S_tridecemlineatus300252 A-TCACCGCAGCGCGCTGACA T_belangeri300405 AT-CACCGCAGCGCGCTGACC * * **** ****

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved