snOPY snoRNA Orthological Gene Database

Family: SNORD47

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300147 AACCAGTGATGT--ATGATTTTGCCAGATGACATAG--AATGCTATCACT C_familiaris300183 AACCAGTGATGT-AGTGATTCTGCCAAATGAAATAG--AATGATATCACT D_rerio300085 AACCTGTGA-CGACATGATTCTGCCAAATGAATC-T--AATGATTATACC D_rerio300086 AACCTGTGA-TGAAATGATTCTGCCAAATGAATCCT--AATGATTATACC D_novemcinctus300014 AACCAGTGATGT-AATGATTCTGCCAAATGAAGTAG--AATGATATCACT D_novemcinctus300415 AACCAGTGATGT-AATGATTCTGCCAAATGAAGTAG--AATGATATCACT E_telfairi300156 AACCAATGA-TGTAATGATTCTGCCAAATGAAACAT--CATGATATTACT E_caballus300090 AACCAGTGATGT-GATGATTCTGCCAAATGAAATAG--AATGATATCACT E_europaeus300145 AACCAGTGATGC-ACTGATTCTGCCAAATGA-GTAA--AATGATATCACA E_europaeus300179 AACCAGTGATGC-ACTGATTTTGCCAAATGAAGTAG--GAGGATATCACT E_europaeus300515 AACCAGTGATGC-ACTGATTCTGCCAAATGA-GTAA--AATGATATCACA H_sapiens300198 AACCAATGATGT-AATGATTCTGCCAAATGAAATAT--AATGATATCA-C L_africana300383 AACCAGTGATGT-AATGATTCTGCCAAATGAAATAG--AATGATATCACT M_mulatta300183 AACCAATGATGT-AATGATTCTGCCAAATGAAATAT--AATGATATCA-C M_murinus300017 AACCAATGATGT-AATGATTCTGCCAAATGAAATAG--AATGATATCACT M_murinus300294 AACCAATGATGT-AATGATTCTGCCAAATGAAATAG--AATGATACCACT M_domestica300029 AACCAGTGATGTTAATGATTCTGCCAAATGAAATGGC-AATGATTTCACC M_musculus300641 AACCAGTGA-TGTGATGATTCTGCCAAATGATACAA--AGTGATATCACC O_anatinus303320 AATGAATGA-ATGAAAGATTCTGTCAAATGAAATAG--ACTGATTTCACC O_anatinus303345 AATGAATGA-ATGAAAGATTCTGTCAA-TGAAATAG--ACTGATTTCACC O_anatinus303581 AACTGGTGATGTTGATGATTTTGCCTAATGAAATGCACACTGTTTTCACC O_anatinus303582 AACCAATGA-TGATAAGATTCTGCCAAATGAAAGAG--ACTGATTTCACC O_anatinus304419 AACCAATGA-TGATAAGATTCTGCCAAATGAAAGAG--ACTGATTTCACC O_anatinus304420 AACTGGTGATGTTGATGATTTTGCCTAATGAAATGCACA--GTTTTCACC O_anatinus304435 ----------------------GTCAAATGAAATAG--ACTGATTTCACC O_latipes300022 AACCGATGA-TGAAACGATTCTGCCAAATGACTGCT--GCTGATTATAAC O_garnettii300068 GATCAATGGTGT-AATGATTCTGCCCAATGAGATAG--AATGATATCATT O_garnettii300355 AACCAATGATAT-AATGATTCTGCTAAATGAAATGG--AATGGTATCACT P_troglodytes300173 AACCAATGATGT-AGTGATTCTGCCAAATGAAATAT--AATGATATCA-C P_pygmaeus300576 AACCAATGATGT-AATGATTCTGCCAAATGAAATAT--AATGATATCA-C R_norvegicus300118 AACCAACAA-TCCAATGATTCTGCCAAATGATACAA---GTGATATCACC R_norvegicus300171 AACCAGTGA-TGTGATGATTCTGCCAAATGATACAA--AGTGATATCACC S_tridecemlineatus300266 AACCAGTGATGT-AATGATTCTGCCAAGTGAA-----------------T T_nigroviridis300008 TTCCTGTGA-TGATCAGATTCTGCCAGATGATTTCT--GATTATAATAAA T_belangeri300141 AACCAATGATGTTAATGATTCTGCCAAATGAAATAG--AATGATATCACT * *** C_familiaris300147 CATAAAACCATTCCATTTTGTGGTT------ C_familiaris300183 CATAAAACCGTTCCATTTTGATTCTGAGGTT D_rerio300085 CCA--ACCGT-TCCATATTT---CTGAGGTT D_rerio300086 CCA--ACCGT-TCCATATTT---CTGAGGTT D_novemcinctus300014 C--AAAACCGTTCCATATTGTTTCTGAGGTT D_novemcinctus300415 C--AAAACCGTTCCATATTGTTTCTGAGGTT E_telfairi300156 CAATAACCGT-TCCATTTTAATTCTGAGGTT E_caballus300090 TATAAAACCGTTCCATTTTGATTCTGAGGTT E_europaeus300145 TACTAAACCGTTCCATTTTT-CTCTGAGGTT E_europaeus300179 TATTAAATTGTCCCATTCTC-CTCTTAGGCT E_europaeus300515 TACTAAACCGTTCCATTTTT-CTCTGAGGTT H_sapiens300198 TGTAAAACCGTTCCATTTTGATTCTGAGGTT L_africana300383 CA-AAAACCGTTCCATTTTAATTCTGAGGTT M_mulatta300183 TATAAAACCGTTCCATTTTGATTCTGAGGTT M_murinus300017 TA-AAAACCGTTCCATTTTGTT-CTGAGGTT M_murinus300294 TAAAAAAATT----ATTTTAA-----AAATT M_domestica300029 CATATACCGT-TCCACTTTTATTCTGAGGTT M_musculus300641 TTTA-AACCGTTCCATTTTATTTCTGAGGTT O_anatinus303320 TATCAACTGT-CCAATTTTTATTCTGAGGTT O_anatinus303345 TATCAACTGT-CCAATTTTTATTCTGAGGTT O_anatinus303581 CAATAAACTAT-----------GCTGAGGTT O_anatinus303582 TATAAAACGTTCCTTTTTTTATTCTGAGGTT O_anatinus304419 TATAAAACGTTCCTTTTTTTATTCTGAGGTT O_anatinus304420 CAATAAACTAT-----------GCTGAGGTT O_anatinus304435 TATAAACCGT-TCCATTTTTATTCTGA---- O_latipes300022 CCTTTACCGT-TCCATTTTTG-TCTGAGGTT O_garnettii300068 TGTAAAACTATTCCATTTTGATTCTGAGGTT O_garnettii300355 TGTAGAACCAGTCCATTTTGGTTCTAAGGTT P_troglodytes300173 TGTAAAACCGTTCCATTTTGATTCTGAGGTT P_pygmaeus300576 TATAAAACCGTTCCATTTTGATTCTGAGGTT R_norvegicus300118 TTTGAAACCAGTCCATTTTATTTCTGAGGTT R_norvegicus300171 TTTACAACCGTTCCATTTTATTTCTGAGGTT S_tridecemlineatus300266 GTTAAAACCATTCCATTTTGATACTGAGGTT T_nigroviridis300008 T----ACCGT-TCCATTATT--TCTGAGGTT T_belangeri300141 TATAAAACCGTTCCATTTTGATACTGAGGTT *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved