snOPY snoRNA Orthological Gene Database

Family: SNORD46

CLUSTAL W (1.83) multiple sequence alignment C_elegans300037 -------------------------------------------------- C_familiaris300435 -------------------------------------------------- D_rerio300189 -------------------------------------------------- D_novemcinctus300066 -------------------------------------------------- D_melanogaster300240 -------------------------------------------------- E_caballus300288 -------------------------------------------------- E_europaeus300228 -------------------------------------------------- E_europaeus300638 -------------------------------------------------- H_sapiens300662 -------------------------------------------------- M_mulatta300048 -------------------------------------------------- M_mulatta300308 -------------------------------------------------- M_mulatta300579 -------------------------------------------------- M_murinus300448 -------------------------------------------------- M_musculus300956 -------------------------------------------------- M_lucifugus300996 -------------------------------------------------- O_cuniculus300297 -------------------------------------------------- O_garnettii300687 -------------------------------------------------- P_troglodytes300024 -------------------------------------------------- P_troglodytes300522 -------------------------------------------------- P_pygmaeus300090 -------------------------------------------------- P_pygmaeus300596 -------------------------------------------------- R_norvegicus300912 -------------------------------------------------- S_cerevisiae300052 TTTAATGATGAAGATTTTAATTTTCCGTTGGTCTATTAAGAACAGAAGTA S_tridecemlineatus300291 -------------------------------------------------- T_nigroviridis300142 -------------------------------------------------- T_belangeri300368 -------------------------------------------------- C_elegans300037 -------------------------------------------------- C_familiaris300435 -------------------------------------------------- D_rerio300189 -------------------------------------------------- D_novemcinctus300066 -------------------------------------------------- D_melanogaster300240 -------------------------------------------------- E_caballus300288 -------------------------------------------------- E_europaeus300228 -------------------------------------------------- E_europaeus300638 -------------------------------------------------- H_sapiens300662 -------------------------------------------------- M_mulatta300048 -------------------------------------------------- M_mulatta300308 -------------------------------------------------- M_mulatta300579 -------------------------------------------------- M_murinus300448 -------------------------------------------------- M_musculus300956 -------------------------------------------------- M_lucifugus300996 -------------------------------------------------- O_cuniculus300297 -------------------------------------------------- O_garnettii300687 -------------------------------------------------- P_troglodytes300024 -------------------------------------------------- P_troglodytes300522 -------------------------------------------------- P_pygmaeus300090 -------------------------------------------------- P_pygmaeus300596 -------------------------------------------------- R_norvegicus300912 -------------------------------------------------- S_cerevisiae300052 CTTCAAAACTACTTTTTAAGACCATCCTTTTACAGTATTTTTTCAATATT S_tridecemlineatus300291 -------------------------------------------------- T_nigroviridis300142 -------------------------------------------------- T_belangeri300368 -------------------------------------------------- C_elegans300037 -------------------------------------------------- C_familiaris300435 -------------------------------------------AACCGGA D_rerio300189 -------------------------------------------AATGTGG D_novemcinctus300066 -------------------------------------------AACTAGA D_melanogaster300240 -----------------------------------------TGTTATAGT E_caballus300288 -------------------------------------------GACTAGA E_europaeus300228 -------------------------------------------AACTAAA E_europaeus300638 -------------------------------------------AACTAGA H_sapiens300662 ---------------------------------------------GTAGG M_mulatta300048 -------------------------------------------TACTGGA M_mulatta300308 -------------------------------------------TGCTGGA M_mulatta300579 -------------------------------------------AAGTAAG M_murinus300448 -------------------------------------------AACTGGA M_musculus300956 -------------------------------------------AACTAGG M_lucifugus300996 -------------------------------------------TGACTGA O_cuniculus300297 -------------------------------------------AACTGGA O_garnettii300687 -------------------------------------------AAGCAGA P_troglodytes300024 -------------------------------------------TGCTGGA P_troglodytes300522 -------------------------------------------AAGTAGG P_pygmaeus300090 -------------------------------------------TACTAGA P_pygmaeus300596 -------------------------------------------AAGTAGG R_norvegicus300912 -------------------------------------------AACTAGG S_cerevisiae300052 GTAAAACTTCTCATTTACTTTGTGTCTTTATGATCTCATCGTTCTGGTGG S_tridecemlineatus300291 -------------------------------------------AACTAGA T_nigroviridis300142 -------------------------------------------GGCGTGG T_belangeri300368 -------------------------------------------CACTAGG C_elegans300037 -------------------TCCACATGA-TGAT-----ACAACCATAG-- C_familiaris300435 GTGATGAGAAA-GAATCCTTAGGTGTGG-TTGG----GGCCGTCTTGG-- D_rerio300189 GTGATGTTAAC-ATGTCCTTAGGTTGGTCTTATTT--GGCCGTCTTGG-- D_novemcinctus300066 GTGATGAAAAA-GTATCCTTAGGCGTGG-TTGT----GGTCGTCTTGG-- D_melanogaster300240 GATGTAAAAACCCTAGCGATCCAGCTACTTTATTGT-GTTGATCTTGTTT E_caballus300288 GTGATGAAAAA-GTATCCTTAGGTGTGG-TTGT----GGCCGTCTTGG-- E_europaeus300228 GTGATGAAAAA-GTACCCTTAGGCATGG-TTGT----GACCATCTTGT-- E_europaeus300638 GTGATGAAAAA-GTGCCCTTAGGCGTGG-TTGT----GACCGTCTTGG-- H_sapiens300662 GTGATGAAAAA-GAATCCTTAGGCGTGG-TTGT----GGCCGTCTTGG-- M_mulatta300048 GTGATGAAAAATGTATCTTCAGGTGTGG-CTGT----GGCCACCTTGG-- M_mulatta300308 GTGATGAAAAA-GTATCTTCAGGTGTGG-CTGT----GGCCACCTTGG-- M_mulatta300579 GTGATGAAAAA-GAATCCTTAGGCGTGG-TTGT----GGCCGTCTTGG-- M_murinus300448 GTGATGAAAAAATTATCCTTAGGCATGG-TTGT----GGCCGTCTTGG-- M_musculus300956 GTGATGAAAAC-GTATCCTTAGGCGTGG-TTAT----GGCCGTCTTGG-- M_lucifugus300996 GTGATGAAAACAGGATCCTTAGGCCTGG-C-GT----GGCCGTCTTGG-- O_cuniculus300297 GTGATGAAAGA-GTATCCTTAGGCGTGG-TGGT----GGCCGTCTTGG-- O_garnettii300687 GTGATGAAAAAAT-ATCCTTAGGCGTGG-TTGT----GGCTGTCTTGG-- P_troglodytes300024 GTGATGAAAAA-GTATCTTCAGGTGTGG-CTGT----GGCCACCTTGG-- P_troglodytes300522 GTGATGAAAAA-GAATCCTTAGGCGTGG-TTGT----GGCCGTCTTGG-- P_pygmaeus300090 GTGATGAAAAA-GTATCTTCAGGTGTGG-CTGT----GGCCACCTTGG-- P_pygmaeus300596 GTGATGAAAAA-GAATCCTTAGGCGTGG-TTGT----GGCCGTCTTGG-- R_norvegicus300912 GTGATGAAAAA-GTATCCTTAGGCGTGG-TTCT----GGCCGTCTTGG-- S_cerevisiae300052 ACCATAATCAGACGCACGGTATACTTCGTTTCTGTTGGAGAATATTGGGA S_tridecemlineatus300291 ATGATGAAAAAAGTATCCTTAGGCGTGG-TTGT----GGCCGTATTGG-- T_nigroviridis300142 GTGATGATCAC-TTGACCTTAGGTATGTCTTGTTTTGGGCCGTTTTGG-- T_belangeri300368 GTGATGAAAAA-GCATCCTTAGGCGTGG-TTGT----GGCCGTCTTGG-- * C_elegans300037 ---CATGAGC-TGGC-AGCAGTGATCGCTAAA---T--GTCATAGTTACA C_familiaris300435 --CCACCTGTGTGCC-ACATGCCAGTGCTAGGACTT--GTCATAGTTACA D_rerio300189 --TCAAAGTCTTTG--ACCTTCCAATGTTAGGATTC--GTCATAGTTACA D_novemcinctus300066 --TCACATATGTGCC-ACTTGCCTATGCTAGGACCT--GTCATAGTTACA D_melanogaster300240 TAAGAGAGACGCAAG-CCTGTTGGGTGTGATTCTGCTTGTCATAGTTACT E_caballus300288 --TCACCTCTGTGCC-ACTTGCCAATGCTAGGACTT--GTCATAGTTACA E_europaeus300228 --TCGCATTTCTGCC-ACTCGCCAATGCTGGGGTTT--GTCATAGTTACA E_europaeus300638 --TCGCATTTGTGCC-ACTTGCCGATGCAGGGATCT--GTCATAGTTACA H_sapiens300662 --TCACCTGTGTGCC-ACTTGCCAATGCAAGGACTT--GTCATAGTTACA M_mulatta300048 --CCACCTGTGTGTC-ACTTGCCCATGCAAGGACTT--GTCATAGTTACA M_mulatta300308 --CCACCTGTGTGTC-ACTTGCCAATGCAAGGACTT--GTCATAGTTACA M_mulatta300579 --TCACCTGTGTGCC-ACTTGCCAATGCAAGGACTT--GTCATAGTTACA M_murinus300448 --TCACGTGTGTGCC-ATTTGCCAATGCAAGGACAT--GTCATAGTTACA M_musculus300956 --CCACCTGTACACC-ACTTGCCAATGCAAGGACTT--GTCATAGTTACA M_lucifugus300996 --CCGC-TGTGAGCC-ACTGGCCGATGCTGGGACTC--GTCATAGTTACA O_cuniculus300297 --TCACTTA-GTGCC-ACTTGCCAGTGCAAGGACTT--GTCATAGTTACA O_garnettii300687 --TCACG-ATATGCC-ACTTGCCAATGCAAGGACTT--GTCATAGTTACA P_troglodytes300024 --CCACCTGTGTGTC-ACTTGCCAATGCAAGGACTT--GTCATAGTTACA P_troglodytes300522 --TCACCTGTGTGCC-ACTTGCCAATGCAAGGACTT--GTCATAGTTACA P_pygmaeus300090 --CCACCTGTGTGTC-ACTTGCTAATGCAGGGACTT--GTCATAGTTACA P_pygmaeus300596 --TCACCTGTGTGCC-ATTTGCCAATGCAAGGACTT--GTCATAGTTACA R_norvegicus300912 --TCACCTGTATGCC-ACTTGCCAATGCAAGGACTT--GTCATAGTTACA S_cerevisiae300052 GTCTTTTAATGTGATGAGTGGCCAACATAACCTTATA-GTCATAGTTACA S_tridecemlineatus300291 --TCACCTGTGTGCC-ACTTGCCAGTGGAAGGACTT--GTCATAGTTACA T_nigroviridis300142 --TTCAATGTTTGA--ACTTACCAATGAGAGGACTT--GTCATAGTTACA T_belangeri300368 --TCACCTGTGTGCC-ACTTGCCAATGCAAGGACTT--GTCATAGTTACA *********** C_elegans300037 CAGATGGG-- C_familiaris300435 CTGACTGTGT D_rerio300189 CTGACACATG D_novemcinctus300066 CTGACTGTTA D_melanogaster300240 CTGATCAGAC E_caballus300288 CTGACTGTCG E_europaeus300228 CTGACTGGTA E_europaeus300638 CTGACTGGTA H_sapiens300662 CTGACT---- M_mulatta300048 CTGACTGTTA M_mulatta300308 CTGACTGTTA M_mulatta300579 CTGACTGTTG M_murinus300448 CTGACTATGT M_musculus300956 CTGACTGTTA M_lucifugus300996 CTGACCGTTC O_cuniculus300297 CTGACTGGTG O_garnettii300687 CTGACTGCAA P_troglodytes300024 CTGACTGTTA P_troglodytes300522 CTGACTGTTG P_pygmaeus300090 CTGACTGTTA P_pygmaeus300596 CTGACTGTTG R_norvegicus300912 CTGACTGTTA S_cerevisiae300052 CTGATT---- S_tridecemlineatus300291 CTGACAGTTA T_nigroviridis300142 CTGACACGCG T_belangeri300368 CTGACTGCTG * **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved