snOPY snoRNA Orthological Gene Database

Family: SNORD44

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300179 CCTGTATGATGATAA-GCAAATACTGACTGAAC-ATGAAGGTCTTAATTA C_porcellus300559 CCTGGATGATGATAA-GCAAATACTGACTGAACTATGAAGGTCTCAATTA D_novemcinctus300018 CCTGTATGATGATAAGCAAATGCTTGACTTAAC-ATGAAGGTCTTA-TTA E_telfairi300159 CCTGTGTGATGATAA-GCAAATGCGGACTAAAG-ATGAAGGTCTTAATTA E_caballus300094 CCTGTATGATGATAA-GCGAATACTGACTGAAC-ATGAAGGTCTTAATTA F_catus300121 CCTGGATGATGATAA-GCAAATACTGACTGAAC-ATGAAGGTCTTAATTA H_sapiens300202 CCTGGATGATGATAA-GCAAATGCTGACTGAAC-ATGAAGGTCTTAATTA M_mulatta300187 CCTAGATGATGATAAGCAAATA-CTGACTGAAC-ATGAAGGTCTTAATTA M_mulatta300477 CCTGGGTGATGACAA-GCAAATGGTGCCTGAAT-GTGAAGGTCATATTTG M_murinus300021 CCTGGATGATGATAAAGCAAATACTGACTGAA-CATGACGGTCTTAATTA O_anatinus304425 CCTGTATGATGATGCTGCAAAGACTGATTCAATCATGATGGTCTTA-TTA O_garnettii300001 CCTGGATGATGATAAAGCAAGTACAGACTGAA-AGTGA-AGTCTTAATTA P_troglodytes300108 CCTGGGTGATGATAA-GCAAATGATGCCTGAAT-GTGAAGGTCATACTCG P_troglodytes300177 CCTGGATGATGATAA-GCAAATGCTGACTGAAC-ATGAAGGTCTTAATTA P_pygmaeus300318 CTGGGGTGACGATAA-GCAAATGGTGCCTGAAT-GTGAAGGTCATATTCG P_pygmaeus300572 CCTGGATGATGATAA-GCAAATACTGACTGAAC-ATGAAGGTCTTAATTA R_norvegicus300167 CCTACATGATGACAA-ACAAATGCTGACTAATG--TGAAGATCTTAATTA S_araneus300009 CCTGCATGATGATAA-GCAAAGACTGACTCAAA-GTGAAGGTCTTA-TTA S_tridecemlineatus300097 CCTGGATGATGATAAGAAGATAACTGATTGAAC-GTGAAGTTTTTAATTA T_belangeri300145 CCTGGATGATGATAA-GCAAATACTGACTGAA-TATGAAGGTCTTAATTA T_belangeri300239 TCAGGATGGTGATAA-GCAACTTCTGACTAAAC-AAGAAGGTCTTAATCA ** ** * * * * ** * * * C_familiaris300179 GCTCTACCTGACAT- C_porcellus300559 GCTCTAACTGATC-- D_novemcinctus300018 GCTCTAACTGATT-- E_telfairi300159 GCTCTAGCTGAT--- E_caballus300094 GCTCTACCTGATT-- F_catus300121 GCTCTACCTGATT-- H_sapiens300202 GCTCTAACTGACTAA M_mulatta300187 GCTCTAACTGATT-- M_mulatta300477 GCTTTAACTGATT-- M_murinus300021 GCTCTAACTGATT-- O_anatinus304425 GCTCTACCTGATC-- O_garnettii300001 GCTCTAACTGATT-- P_troglodytes300108 GCTTTAGCTGATT-- P_troglodytes300177 GCTCTAACTGACT-- P_pygmaeus300318 GCTTTAGCTGATT-- P_pygmaeus300572 GCTCTAACTGACT-- R_norvegicus300167 GCTCTATCTGATGT- S_araneus300009 GCTCTACCTGACGC- S_tridecemlineatus300097 GCTCTAACTGATT-- T_belangeri300145 GCTCTAACTGATT-- T_belangeri300239 CCTCTAACTGATT-- ** ** ****

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved