snOPY snoRNA Orthological Gene Database

Family: SNORD42

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300317 -GTGCATATGATGGA---AAAATCTTAATCTCCTGAGACTTGTGATGTCT C_familiaris300319 -ATGCAAATGATGGAA--AA-GTCACTATTT--AGGAAAGAATGACATGA C_porcellus300913 -GTGCATATGATGGAAAAAAAGTTAATCTCC--TGAGATTTGTGATGTCT C_porcellus300915 -GTGCAAATGATGGA---AAATTCACTATTT--GGAAAAGAATGACATGA D_rerio300150 -CTGCATATGATGTAAATTAAGTTTCTGCCT--GAATGATTGTGATGCAT D_novemcinctus300537 -GTGCGTATGATGGAAAAAAACTTAACCTTC--TGAGAGTTATGATGCCT D_novemcinctus300539 -GCGCAAATGATGGA---AAAATCACTATTTGGA--AAAGAATGACATGA E_telfairi300874 -GTGCGTATGATGGAAAAAAAAC--ATAGTC--TGAGATGCGTGATGTCT E_telfairi300875 -GCGCAGATGATGGAAACAAAATCACTATTTGGAGAAAAGAATGACACGA E_caballus300131 ---GTAAATTTTATCTATAAGGAAGCAAAAACCTGAGACTCGTGATGTCT E_caballus300336 -GTGCACATGATGGAAAAAATTAAACCACCT---GAAATTTGTGATGTCT E_caballus300338 -GCGCAAATGATGGA---AAAATCACTATTTGGA--AAAGAATGACATGA E_europaeus300617 -GTGCAAATGATAGA---AAAATTTTAATCT---GAGACTGGTGATGTCT E_europaeus300681 -GTGCAAATGATAGA---AAAATTTTAATCT---GAGACTGGTGATGTCT F_catus300325 -GTGCATATGATGGA---AAAATTGTAACCTCCTGAGACTTATGATGTCT G_gallus300057 -------------------------------------------------- H_sapiens300706 -GTGCATATGATGGAA--AAG-TTTTAATCTCCTGACACTTGTGATGTCT H_sapiens300708 ------AATGATGGA---AAAATCATTAT-T--GGAAAAGAATGACATGA L_africana300515 -GTGCAAATGATGGAA--AA-ATCACTATTT--GGAAAAGAATGACATGA M_mulatta300042 -TAGCATATGATGGA---AAAATCTTAATCTTCTGAGACTTGTGATGTCC M_mulatta300288 -GTGCATGTGATGGAA--AAG-TTTTAATCTCCTGACATTTGTGATGTCT M_mulatta300290 ----GGGTTGATGGA---AAAATAATCAT-T--GGAAAAGAATGACATGA M_murinus300387 -GTGCATATGATGGA---AAAATCTTAATCTCCTGAGACTTGTGATGTCT M_murinus300389 -GGGCAAATGAGAGA---AAGATAATTATCT--GGAAAAGAGTGACAGGA M_domestica300095 -ATGCCAATGATGGAA--ACATGTATT-TTCCTGAGAATAC-TGATGTTG M_domestica300097 -ATGCAAATAATGGAAA-AATATCATTTTACCGGAAAAAAAATGATGCTA M_musculus300937 -GTGCAAATGATGGA---AAACTCAATGTTT--GGAAAAGAATGACACCA M_musculus300939 -GTGCATATGATGGAAA-AAATCTGAAGTCTCCTGAGACCTGTGATGTCT M_lucifugus300577 -AAGGAAATGATGGCA--AA-ATCACTATTTGAGGAGCAAATT-ACATAA M_lucifugus300616 -GTGCATATGATGGAAA-AACTTTTAAG----CTGAGACTTGTGATGTCT O_anatinus304482 -GTGCAGATGATGGA---AAAGT--TTTTTTGCTGACAAAAGTGATGTTA O_anatinus304484 -GTGTCAATGATGGAA--AACTTTCCT--GGCTGAGAACAG-TGATGTTG O_cuniculus300393 -TTGCAAATGATGGA---AAACGCACTATTT--GGAAAAGAATGACACCT O_cuniculus300462 -GTGCATATGATGGA---AAAATCTTAATTTCCTGAGACTTATGATGTCT O_cuniculus300464 -GCGCAAATGATGGA---AAACGCACTATTT--GGAAAAGAATGACACCT O_garnettii300690 -GTGCATATGATGGA---AAAATCTTAATTTCCTGAGATTTGTGATGTCT P_troglodytes300235 -TAGCATATGATGGA---AAAATCTTAATCTTCTGAGACTTGTGATGTCT P_troglodytes300587 -GGGCTAATGATGGA---AAAATCATTAT-T--GGAAAAGAATGACATGA P_troglodytes300589 -GTGCATATGATGGAA--AAG-TTTTAATCTCCTGACACTTGTGATGTCT P_troglodytes300615 -AGCCCTAAAATGGACA-AAATTTAAAATTACTTAGACAATGTGATGTCA P_pygmaeus300530 --AGCATATGATGGA---AAAACCTTAATCTTCTGAGACTTGTGATGTCT P_pygmaeus300774 -GTGCATATGATGGAA--AAG-TTTTAATCTCCTGACACTTGTGATGTCT P_pygmaeus300776 -GGCCTAATGATGGA---AAAATCATTAT-T--GGAAAAGAATGACATGA R_norvegicus301050 -GTGCATATGATGGAAA-AAATTTGAAGTCTCCTGAGACCTGTGATGTCT R_norvegicus301052 --TGCAGATGATGGA---AAACTCAATGTTT--GGAAAAGAATGACACCA S_araneus300376 -CTCCAGCAGCCTGA---AAAATATTAATTTCCTGAGACTTGAGATGTAT S_araneus300382 -ATGCATATGATGGAA--AAAATTTTAATCTCCTGAGACTTGTGATGTCT S_araneus300454 -ATGCATATGATGGAA--AAAATTTTAATCTCCTGAGACTTGTGATGTCT S_araneus300575 -ATGCATATGATGGAA--AAAATTTTAATCTCCTGAGACTTGTGATGTCT S_tridecemlineatus300054 -TTGCAAATGATGGA---AAAATCACTATTTGGA--AAAGAATGACATGA S_tridecemlineatus300223 -GAGCATAAGAAGAA---AAATTCTTAATCTCCTGAGACTTGTGATCTCT S_tridecemlineatus300263 -GTGCATATGATGGA---AAAATCGTGATCTCCTGAGATTTATGAAGTTT T_nigroviridis300053 -GTGCAAGTGATGCAA--ACTTTTACTATAGCTGAATGTATGTGATGCAT T_belangeri300195 TTCCACAATGATGGAA--AAGATCACTATTGGGGGAAAAAAATGACATGA T_belangeri300305 -GTGCATATGATGGAA--AAA-TTTTAAT---CTGACACTAGTGATGTCT T_belangeri300307 --GCACAATGATGGAA--ACAA--ACTATTT--AGAAGAGAATGATATGA X_tropicalis300042 -TTGCAAATGATGGAA--A-TGTTATTTGGACTGAATACAT-TGATGAGC X_tropicalis300135 -GTGCGAATGATGGA---AAACATATTAATGCTGAAAATAT-TGATGTTT C_familiaris300317 TCA---AAGGAACC-ACT--GATGCAC-- C_familiaris300319 ACA---AAGGAACT-GCT--GATGTGC-- C_porcellus300913 CCA---AAGGAACC-ACT--GATGCAC-- C_porcellus300915 ACA---AAGGAACC-GCT--GATGCAC-- D_rerio300150 TCA---AAGGAACC-ACT--GATGCTC-- D_novemcinctus300537 TCA---AAGGAACC-ACT--GATGCAC-- D_novemcinctus300539 ACA---AAGGAACC-ACT--GATGGCGC- E_telfairi300874 TCA---AAGGAACC-ACT--GACGCAC-- E_telfairi300875 ACA---AAGGAACC-ACT--GATG-CGC- E_caballus300131 TCA---AAGGAACA-ACT--GATGTAC-- E_caballus300336 TCA---AAGGAACC-GCT--GATGCAC-- E_caballus300338 GCA---AAGGAACC-ACT--GATG-CGC- E_europaeus300617 TCA---AAGGAACC-ACT--GATGCAC-- E_europaeus300681 TCA---AAGGAACC-ACT--GATGCAC-- F_catus300325 TCA---AAGGAACC-GCT--GATGCAC-- G_gallus300057 ----------------------------- H_sapiens300706 TCA---AAGGAACC-ACT--GATGCAC-- H_sapiens300708 ACA---AAGGAACC-ACT--GAAGTG--- L_africana300515 ACA---AAGGAACC-GCT--GATGTGC-- M_mulatta300042 TCA---AAAGAACC-ACT--GATGCAT-- M_mulatta300288 TCA---AAGGAACC-ACT--GATGCAC-- M_mulatta300290 ACA---GAGGAACC-ATT--GAAGTGC-- M_murinus300387 TCA---AAGGAACC-ACT--GATGCAC-- M_murinus300389 ACA---AAGGAACC-ACT--TAAATGCCA M_domestica300095 TCA---AAGGAACC-ACT--GATGGCAT- M_domestica300097 ACA---AAGGAACC-ACT--GATGCAT-- M_musculus300937 ACA---AAGGAACC-ACT--GATGCTG-- M_musculus300939 TCA---AAGGAACC-ACT--GATGCAC-- M_lucifugus300577 ACA---AAGGAACC-ACT--AATGCAC-- M_lucifugus300616 CCA---AAGGAACC-ACT--GATGCAC-- O_anatinus304482 ACA---AAGGAACC-GCT--GATGCAC-- O_anatinus304484 TCA---AAGGAACC-ACT--GATGCAC-- O_cuniculus300393 ACA---AAGGAACC-ACT--GATGCGC-- O_cuniculus300462 TCA---AAGGAACC-ACT--GATGCAC-- O_cuniculus300464 ACA---AAGGAACC-ACT--GATGCGC-- O_garnettii300690 GCA---AAGGAACC-GCT--GATGCAC-- P_troglodytes300235 TCA---AAGGAACC-ACTTCAATGCAA-- P_troglodytes300587 ACA---AAGGAACC-ACT--GAAGTGC-- P_troglodytes300589 TCA---AAGGAACC-ACT--GATGCAC-- P_troglodytes300615 TCA---AAGGAACC--CT---AAGTA--- P_pygmaeus300530 TCA---AAGGAACC-ACT--GATGCA--- P_pygmaeus300774 TCA---AAGGAACC-ACT--GATGCAC-- P_pygmaeus300776 ACA---AAGGAACC-ACT--GAAGTGC-- R_norvegicus301050 TCA---AAGGAACC-ACT--GATGCAC-- R_norvegicus301052 ACA---AAGGAACC-ACT--GATGCT--- S_araneus300376 TCA---AAGGTACC-ACTG-GCTGGAG-- S_araneus300382 TCA---AAGGAACC-ACT--GATGCAC-- S_araneus300454 TCA---AAGGAACC-ACT--GATGCAC-- S_araneus300575 TCA---AAGGAACC-ACT--GATGCAC-- S_tridecemlineatus300054 ACA---AAGGAACC-ACT--GACTA---- S_tridecemlineatus300223 TTT---AAGGAATCGACT--GATGAAC-- S_tridecemlineatus300263 TCA---AAGGAACC-ACT--GATGCAC-- T_nigroviridis300053 TCATCAAAGGAACC-ACT--GATGCCA-- T_belangeri300195 ACA---AAGAAACC-ACA--GATGGAA-- T_belangeri300305 TCA---AAGGAACC-ACT--GATGCAC-- T_belangeri300307 ACA---AAGGAACC-ACT--GATGTGC-- X_tropicalis300042 TCA---AAGGAACC-ACT--GATGCAC-- X_tropicalis300135 CCA---AAGGAACC-ACT--GATGCAT--

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved