snOPY snoRNA Orthological Gene Database

Family: SNORD42

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300405 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAGTCATGGGAGCTGAATGT D_rerio300149 GGAGCAATGATGAGTGGCGCAGGGGT-ACGTACCTCAGCTG-ATAATGGGAGCTGAGTGT D_rerio300279 GGAGCAATGATGAGTGGCGCAGGGGT-ACGTACCTCAGCTG-ATAATGGGAGCTGAGTGT D_rerio300291 AGGGCAGTGCTGATTGGCGCAGGGGTGACGGAGCACAGATGCATGCTGGGAAGTGTG-GT D_novemcinctus300588 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAGTCATGGGAGCTGAGTGT E_telfairi300876 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAGCCATGGGAGCTGAATGT E_caballus300374 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAGTCATGGGAGCTGAGTGT E_europaeus300648 AAGGCTGTGATGATTGGTGCAGGGGT-ATGGCCCTCCACTAAGTCATGGGAGCTGAATGT H_sapiens300500 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAGTCATGGGAGCTGAATGT M_mulatta300638 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAGTCATGGGAGCTGAATGT M_murinus300522 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAGTCATGGGAGCTGAATGT M_domestica300139 GAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAATCATGGGAGCTGAATGT M_musculus300739 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAGTCATGGGAGCTGAATGT O_anatinus303524 GTGGCTGTGATGATCGGCGCAGGGGT-ACGGACCTCAGCTGCATCATGGGAGCTGAGTGT O_anatinus303525 GTGGCTGTGATGATCGGCGCAGGGGT-ACGGACCTCAGCTGCATCATGGGAGCTGAGTGT O_anatinus303526 GCGGCGATGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGGATCATGGGAGCTGAATGT O_anatinus303527 GCGGCGATGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGGATCATGGGAGCTGAATGT O_cuniculus300492 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAATCATGGGAGCTGAATGT O_garnettii300626 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAATCATGGGAGCTGAATGT P_troglodytes300599 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAGTCATGGGAGCTGAATGT P_pygmaeus300674 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAGTCATGGGAGCTGAATGT R_norvegicus300925 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAGTCATGGGAGCTGAATGT S_araneus300909 CGGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTATGTCATGGGAGCTGAGTGT S_araneus300981 CAGGCTGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAATCATGGGAGCTGAATGT T_belangeri300291 CAGGCAGTGATGATTGGCGCAGGGGT-ACGGACCTCAGCTGAGTCATGGGAGCTGAATGT X_tropicalis300109 TTTGCAATGATGATTGGCGCAGGGGT-ACCGACCTCAGCTGGATAATGGGAGCTGAGTGC X_tropicalis300110 ACGACTGTGATGATTGGCACAGGGGT-ACGGACCTCAGCTGGATCATGGGAGCTGAATGT * ** *** ** ******* * * * * ***** ** * C_familiaris300405 ATGTG----TTTCTCCTTTG-TCTTGCATGTGGCAGGATGCT--GGGGAGCACTTACAGG D_rerio300149 TGACT----GCTCAAAATCAGTGGAC-ATGTGGTCAGCTGGT-TGTAGGGTGTCAGCACG D_rerio300279 TGACT----GCTCAAAATCAGTGGAC-ATGTGGTCAGCTGGT-TGTAGGGTGTCAGCACG D_rerio300291 TTTCT----GCAGAACTCTACTGTTCTACCTCGTCCT----------------------- D_novemcinctus300588 ACGTG----CGTCCCCCTCG-TCCTGCACGTGGCAGGTCGGT--GGTGAGCACTGACACG E_telfairi300876 CAGTG----TCTCTCCTCCG-TCCTGCATGTGGCAGGGTGCT--GGCGAGCACTGGCATG E_caballus300374 ATGTG----TTTCTCCTTTG-TCCTGCATGTGGCAGGATAAC--GGCGAGCACTTACATG E_europaeus300648 ATGTG----TTTCTCCGTTG-TCCTGCATGTGGTGGGTTGAT--GGCAAGCACTT-CATG H_sapiens300500 ATGTG----TTTCTCCTTTG-TCCTGCATGTGGCAGGCTGAT--GGGGAGCACTTACATG M_mulatta300638 ATGTG----TTTCTCTTTTG-TCCTGCGTGTGGCAGGCTAAT--GGGGAGCACTTACATG M_murinus300522 ATGTG----TTTCTCCTTTG-TCCTGCATGTGGCAGGCTGAT--GGTGAGCACTTACATG M_domestica300139 ATGTG----TGTCTCTGCCC-TCCTGCATGTGGCAGGTTGAT--GGGGAGCACTTACATG M_musculus300739 ATGTG----TTTTGCCTCTG-TCCTGCATGTGGCAGGCTGTT--GGCATTCACATACATG O_anatinus303524 AGGTG----GGTCTCTGAG--TCCTGCACGTGGTAGGACGGA--AGAGAGCACTTACATG O_anatinus303525 AGGTG----GGTCTCTGAG--TCCTGCACGTGGTAGGACGGA--AGAGAGCACTTACATG O_anatinus303526 GAGCCGGGCCTTCCCTGTGGGGCGGACGTGTGGTCTGCCGCCGGGGAGCACGTTCACATG O_anatinus303527 GAGCCGGGCCTTCCCTGTGGGGCGGACGTGTGGTCTGCCGCCGGGGAGCACGTTCACATG O_cuniculus300492 TCGTG----CTTCTCCTTTG-TCCTGCACGTGGCAGGGTGAG--GGGGAGCACTTACATG O_garnettii300626 ATGTG----TTTCTCCTTTG-TCCTGCACGTGGCAGGTTGAT--GGTGAGCACTTACATG P_troglodytes300599 ATGTG----TTTCTCCTTTG-TCCTGCGTGTGGCAGGCTGAT--GGGGAGCACTTACATG P_pygmaeus300674 ATGTG----TTTCTCCTTTG-TCCTGCATGTGGCAGGCTGAT--GGGGAGCACTTACATG R_norvegicus300925 ATGTG----CTCTGCCTCTG-TCTTGCATGTGGTAAGCTGTC--GGCATTCACATACATG S_araneus300909 ATGTG----TTTTGCCTTTG-TCCTGCATGTGGCAGGCTGA---AGCAAGCACTTACACG S_araneus300981 ATGTG----TTTTGCCTTTG-TCCTGCATGTGGCAGGTTGAT--GGCAGGCACTTACATG T_belangeri300291 ACGTG----CATGTCGTCT--TCCTGCATGTGGCAGG-TGAT--GTCA-GCACTTACATG X_tropicalis300109 AGAGCCGTGTCTGTCTGGTTATCCGACGTGTGGTTGGTGGCC-AGGAGACTCTCTGCATG X_tropicalis300110 GAACT----TCCCCCTGAGGTTCCTGCATGTGGTGGGATACCCGGGGGGGCGTTCATATG * * C_familiaris300405 AGACT--TGCCTCAATCTGAGCCTG D_rerio300149 AAATTATCGCCTTGA-CTGAGCTCC D_rerio300279 AAATTATCGCCTTGA-CTGAGCTCC D_rerio300291 ------------------------- D_novemcinctus300588 AGAC-AACGCCTCAATCTGAGCCTG E_telfairi300876 AGACTGGTGCCTCAATCTGAGCCTG E_caballus300374 AGACTGATGCCTTAATCTGAGCCTG E_europaeus300648 AGAC--TTGCCTGACTCAGAGCTTG H_sapiens300500 AGACTGTTGCCTCAATCTGAGCCTG M_mulatta300638 AGACTGTTGCCTCAATCTGAGCCTG M_murinus300522 AGACTGTTGCCTCAATCTGAGCCTG M_domestica300139 AGACTGGTGCCTAAATCTGAGCCTC M_musculus300739 AGACTGTTGCCTTAATCTGAGCCTG O_anatinus303524 AGACTGGTGCCTAAGTCTGAGCCTC O_anatinus303525 AGACTGGTGCCTAAGTCTGAGCCTC O_anatinus303526 AGAATTTCGCCAGACACTGAGCCGC O_anatinus303527 AGAATTTCGCCAGACACTGAGCCGC O_cuniculus300492 AGACT--TGCCGCAATCTGAGCCTG O_garnettii300626 AGACTGTTGCCTCAATCTGAGCCTG P_troglodytes300599 AGACTGTTGCCTCAATCTGAGCCTG P_pygmaeus300674 AGACTGTTGCCTCAATCTGAGCCTA R_norvegicus300925 AGACTGTTGCCTTAATCTGAGCCTG S_araneus300909 AG---GATGCCTCAATCTGAGCCTG S_araneus300981 AGACTGATGCCTTAATCTGAGCCTG T_belangeri300291 AGACTGTTGCCTCAATCTGAGCCTG X_tropicalis300109 ATACAGCCGCCATA--CTGAGCAAC X_tropicalis300110 AGAACAGAGCCTTAATCTGAGCCGC

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved