snOPY snoRNA Orthological Gene Database

Family: SNORD3@

CLUSTAL W (1.83) multiple sequence alignment D_rerio300020 AAGACTATACTTTCAGGGATCATTTCTATAGGTTCTCACTAGGAAATGTGTTTTGAAAGT D_rerio300021 AAGACTATACTTTCAGGGATCATTTCTATAGTTTCTTACTAGGAAATGTGTTTTGAAAGT D_rerio300022 AAGATTATACTTTCAGGGATCATTTCTATAGTTTCTCACTAGGAAATGTGTTTTGAAAGT D_rerio300023 AAGACTATACTTTCAGGGATCATTTCTATAGTTTCTCACTAGGAAATGTGTTTTGAAAGT D_rerio300024 AAGACTATACTTTCAGGGATCATTTCTATAGTTTCTCACTAGGAAATGTGTTTCGAAAGT D_rerio300025 AAGACTATACTTTCAGGGATCATTTCTATAGTTTCTCACTAGGAAATGTGTTTTGAAAGT D_rerio300026 AAGACTATACTTTCAGGGATCATTTCTATAGTTTCTCACTAGGAAATGTGTTTCGAAAGT D_rerio300027 AAGACTATACTTTCAGGGATCATTTCTATAGTTTCTCACTAGGAAATGTGTTTTGAAAGT D_rerio300028 AAGACTATACTTTCAGGGATCATTTCTATAGTTTCTCACTAGGAAATGTGTTTCGAAAGT D_rerio300036 AAGACTATACTTTCAGGGATCATTTCTATAGTTTCTCACTAGGAAATGTGTTTTGAAAGT D_rerio300037 AAGACTATACTTTCAGGGATCATTTCTATAGTTTCTCACTAGGAAATGTGTTTTGAAAGT D_rerio300038 AAGACTATACTTTCAGGGATCATTTCTATAGTTTCTCACTAGGAAATGTGTTTTGAAAGT D_rerio300039 AAGACTATACTTTCAGGGATCATTTCTATAGTTTCTCACTAGGAAATGTGTTTCGAAAGT D_rerio300041 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGA D_rerio300047 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300048 AAGACTATACTTTTAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTTAAGT D_rerio300049 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTTAAGT D_rerio300051 AAGACTATACTTTCAGGGATCATTTCTATAGTTTTAAACTAGGAAATGTGTTTCTAAAGT D_rerio300052 AAGACTATACTTTCAGGGATCATTTCTATAGTTGTTAACTAGGACATGTGTTTCTAAAGT D_rerio300053 AAGACTATACTTTCAGTGATCATTTCTATAGCTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300054 ------------------------------------------------------------ D_rerio300055 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300066 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300068 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300069 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300070 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300071 AAGATTATACTTTCAGGGATCATTTCTATAGTTATTAACTAGGAAATGTGTTTCTAAAGT D_rerio300072 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300073 AAGACTATACTTTTAGAGATCATTTCTATACTTCTTAACTCCGAAATGTGTTTTTAAAGT D_rerio300182 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300231 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300242 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAATT D_rerio300243 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTATCTAGGAAATGTGTTTCTAAAGT D_rerio300244 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300245 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300297 AAGGCTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300298 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_rerio300299 AAGACTATACTTTCAGGGATCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGT D_melanogaster300016 ----------------------TTCACATACTTTCACACTAG----------CTGAAAGC D_melanogaster300017 ----------------------TTCACATACTTTCACACTAG----------CTGAAAGC D_melanogaster300037 ------------------------------CTTTCACACTAG----------CTGAAAGC H_sapiens300112 AAGACTATACTTTCAGGGATCATTTCTATAGTGTGTTACTAGAGAAGTTTCTCTGAACGT H_sapiens300182 AAGACTATACTTTCAGGGATCATTTCTATAGTGTGTTACTAGAGAAGTTTCTCTGAACGT H_sapiens300243 AAGGCTATACTTTCAGGGATCATTTCTATAGTGTGTTACTAGAGAAGTTTCTTTGAACGT H_sapiens300250 AAGACTATACTTTCAGGGATCATTTCTATAGTGTGTTACTAGAGAAGTTTCTCTGAACGT H_sapiens300448 AAGACTATACTTTCAGGGATCATTTCTATAGTGTGTTACTAGAGAAGTTTCTCTGAACGT H_sapiens300723 AAAATTATACTTTCAGCAATCATCTCTATAGTTTGTTACTAGAGAAGCTTCTGTGAATGT D_rerio300020 GTTGTGTCTCCCAAACCGCGATGAAGAGTGTTGATGCTCTTTTCTA-AGCGTGAATCTGG D_rerio300021 GTTGTGTCTCCCAAACCACCATGAAGAGTGTTGATGCTCTTTTCTA-AGCGTGAATCTGG D_rerio300022 GTTGTGTCTCCCAAACCGCGATGAAGAGTGTTGATGGTCTTTTCTA-AGCATGAATCTGG D_rerio300023 GTTGAGTCTCCCGAACTGCGATGAAGAGTGTTGATGCTCTTTTCTA-AGCGTGAATCTGG D_rerio300024 GTTGTGGCTCCCAAACCGTGATGAAGAGTATTGATGCTCTTTTCTA-AGCGTGAATCTGG D_rerio300025 GTTGTGTCTCACAAACCGTGATGAAAAGTGTTGATGCTCTTTTCTA-AGCGTGAATCTGG D_rerio300026 GTTGTGTCTCCCAGACTGCGATGAAGAGTGTTGATGCTCTTTTCTA-AGCGTGAATCTGG D_rerio300027 GTTGAGTCTCCCAAACCGCGATGAAGAGTGTTGATGCTCTTTTCTA-AGCATGAATCTGG D_rerio300028 GTTGTGTTTCCCAAACCGCGATGAAGAGTGTTGATGCTCTGTTCTA-TGCGTAAATCTGG D_rerio300036 GTTGTGTCTCACAAACCGTGATGAAGAGTGTTGATGCTCTTTTCTA-AGCGTGAATCTGG D_rerio300037 GTTGAGTCTCCCAAACCGCGATGAAGAGTATTGATGCTCTTTTCTA-AGCATGAATCTGG D_rerio300038 GTTGAGTCTCCCAAACCGCGATGAAGAGTGTTGATGCTCTTTTCTA-AACGTGAATTTGG D_rerio300039 GTTGTGGCTCCCAAACCGTGATGAAGAGTATTGATGCTCTTTTCTA-AGCGTGAATCTGG D_rerio300041 GTCGAGTCACCCAAACCACGATGAAGAGTGAAGGTGCATTCCTCTG-AGCGTGAATCGGA D_rerio300047 GATGAGTCTCCCAGACCACGATGATGATTCTTGATACTCTTTTCAG-AGCATGAATCAGA D_rerio300048 GATGAGTCTCCCAAACCACGATGATGATTCTTGATACTCTTATCAG-AGCATGAATCAGA D_rerio300049 GATGAGTCTCCCAAACCACGATGATGATTCTTGATACTCTTTTCAG-AGTATGAATCAGA D_rerio300051 GTTGAGTCTCCCAAACCACCATGACGATTCTTGATGCTCTTTTCTG-AGCGTGAATCAGA D_rerio300052 GTGGAGTCTTCCAAACCACGATGATGATTCTTGATACTCTTTTCTG-AGCCTGAATCAGA D_rerio300053 GATGAGTCTCCCAAACCACGATGATGGTTTTTGATACTCTTTTCTG-AGTGTGAATCAGA D_rerio300054 ---------------CTGCAATGATGAGTGAAAGAATGCATCTTGA---CTTGGTATTGT D_rerio300055 GATGAGTCTCCCAAACCACGATGATGATTCTTGATGCTCTTTTCTT-AGCGTGAATCAGA D_rerio300066 GATGAGTCTCCCAAACCACGATGATGATTCTTGATGCTCTTTTCTT-AGCGTGAATCAGA D_rerio300068 GATGAGTCTCCCAAACCACGATGATGATTCTTGATACTCTTTTCTT-AGCGTGAATCAGA D_rerio300069 GATGAGTCTCCCAAACCACGATGATGATTCTTGATGCTCTTTTCTT-AGCGTGAATCAGA D_rerio300070 GATGAGTCTCCCAAACCACGATGATGATTCTTGATACTCTTTTCTT-AGCATGAATCAGA D_rerio300071 GATGAGTCTCCCAAACCACGATGATAATTCTTGATACTCTTTTCTT-AGCGTGAATCAGA D_rerio300072 GATGAGTCTCTCAAACCACGATGATGATTCTTGATACTCTTTTCTT-AGCGTGAATCAGA D_rerio300073 GATTAGTCTCCCAAACCACGATGATGATTCTTGATATTCTTTTCTT-AACGTGACTCAGA D_rerio300182 GTTGAGTCTACCAAACCACGATGATGCTTCTTGATACTCTTTTCTG-AGCATGAATCAGA D_rerio300231 GTCGAGTCTCCCAAACCACGATGAAGAGTGAAGGTGCGTTCCTCTG-AGCGTGAATCGGA D_rerio300242 GATGAGTCTCCCAAACCACGATGATGATTCTTGATGCTCTTTTCTT-AGCGTGAATCAGA D_rerio300243 GATGAGTCTCCCAAACCACGATGATGATTCTTGATGCTCTTTTCTT-AGCGTGAATCAGA D_rerio300244 GATGAGTCTCCCAAACCACGATGATGATTCTTGATGCTCTTTTCTT-AGCGTGAATCAGA D_rerio300245 GATGAGTCTCCCAAACCACGATGATGATTCTTGATGCTCTTTTCTT-AGCGTGAATCAGA D_rerio300297 GATGAGTCTCCCAAACCACGATGATGATTCTTGATACTCTTTTCTT-AGCATGAATCAGA D_rerio300298 GATGAGTCTCCCAAACCACGATGATGATTCTTGATACTCTTTTCTT-AGCGTGAATCAGA D_rerio300299 GATGAGTCTCTCAAACCACGATGATGATTCTTGATACTCTTTTCTT-AGCGTGAATCAGA D_melanogaster300016 CAAGTGC------ACCCGCGTTGATGAGTTGAATCGTTCTATTCGGCAGCGTGAG---GA D_melanogaster300017 CAAGTGC------ACCCGCGTTGATGAGTTGAATCGTTCTATTCGGCAGCGTGAG---GA D_melanogaster300037 CAAGTGC------ACCCGCGTTGATGAGTTGAATCGTTCTGTCCGGCAGCGTGAG---GA H_sapiens300112 GTAGAGCACCGAAAACCACGAGGAAGAGAGGTAGCGTTTTCTCCTG-AGCGTGAAGCCGG H_sapiens300182 GTAGAGCACCGAAAACCCCGAGGAAGAGAGGTAGCGTTTTCTCCTG-AGCGTGAAGCCGG H_sapiens300243 GTAGAGCACCGAAAACCCCGAGGAAGAGAGGTAGCGTTTTCTCCTG-AGCGTGAAGCCGG H_sapiens300250 GTAGAGCACCGAAAACCCCGAGGAAGAGAGGTAGCGTTTTCTCCTG-AGCGTGAAGCCGG H_sapiens300448 GTAGAGCACCGAAAACCACGAGGAAGAGAGGTAGCGTTTTCTCCTG-AACGTGAAGCCGG H_sapiens300723 GTAGAGCACCGGAAACCACAAGGCAAAGGCTCAGCATTCTCTCCTA-AGCGCGAAGCTGG * * * D_rerio300020 TGT-AGAGAAATGGTTTGTCTCATATGCTCTACACTGTT-GATGACCGTCCCTGACTGCT D_rerio300021 TGT-AGAGAAATAGTTCGTCTCATGTGCTCTACACTGTT-GATGACTGCTCCTGACTGTT D_rerio300022 TGT-AGAGAAATGGTTTGTCTCATATGCTCTACACTGTT-GATGACTGCTCCTGACTGCT D_rerio300023 TGT-AGAGAAATGGTTTGTCTTATACGCTCTACACTGTT-GATGACCGTTCCTGACTGCT D_rerio300024 TGT-AGAGACATGGTTTGTCTCATATGCTCTACACTGTT-GATGACTGCTCCTGACTGTT D_rerio300025 TGT-AGAGAAATGATTTGTCTCATACGCTATACACTGTT-GATGACTGCTCCTGACTGCT D_rerio300026 TGT-AGAGAAATGATT-GTCTCATTCGCTCTACAATATT-GATGACCGTTCCTGACTGCT D_rerio300027 TGT-AGAGAATTGGTTTGTCTCATCTGCTTTACACTGTT-GATGACTGCTCCTGACTGTT D_rerio300028 TGT-AGAGAAATGGTTTGTCTCATATGCTCTACACTGTT-GATGACCGCTCCTGACTGAT D_rerio300036 TGT-AGAGAAATGATTTGTCTCATACGCTATACACTGTT-GATGACTGCTCCTGACTGCT D_rerio300037 TGT-AAAGAATTGTTTTGTCTCATCTGCTTTACACTGTT-GATGACTGCTCCTGACTGTT D_rerio300038 TGT-AGAGAAATGATT-GTCTTATTCGCTCTACAATATT-GATGACTGTTCCTGACTGCT D_rerio300039 TGT-AGAGAAATGGTTTGTCTCATATGCTCTACACTGTT-GATGACTGCTCCTGACTGTT D_rerio300041 TAA-TAATCTGCGGGATAAC-CATGGATAAT-TATCATT-GATGAACGTTCTGCGATTCT D_rerio300047 TGT-AGAGAGATGATTTGATTCATATACTCTATATCATT-GATGAATGTTCTTTGTTGTA D_rerio300048 TTT-AGAGAGATGATTCGATTCATATGCTCTGTATCTTT-GATGAATGTTCTTTGTTGCA D_rerio300049 TGT-AGAGAGATGATTTGATTCATATGCTCTGTATCATT-GATGAATGTTCTTTGTTGCA D_rerio300051 TGC-AGACAAATGATTTAATTCATATCCTCTGTATCATT-GATGATTGTTCCTTGTTGTG D_rerio300052 TGC-AGAGAAATGATTTAATTCATATTCTCTGTATCTTT-GATGAATGTTCCTTGTTGTC D_rerio300053 TGC-AGAGAGTTGATTTAATTTACTTGCTCTGTATCATT-GTTGAATTTACTTTGTTGTG D_rerio300054 TGC--------TTTTTGGCATCATTGACCAAGGTTTGATTGAGGTTTAATCTTCTCTCTG D_rerio300055 TGC-AGAGAGATGATTCAATTCATGTGCTCTGGATCATT-GATGAATGTTCCTCGTTGTG D_rerio300066 TGC-AGAGAGATGATTCAATTCATGTGCTCTGGATCATT-GATGAATGTTCCTCGTTGTG D_rerio300068 TGC-AGAGAGGTGATTCAATTCATGTGTTCTGGATCATT-GATGAATGTTCCTCGTTGTG D_rerio300069 TGC-AGAGAGATGATTCAATTCATGTGCTCTGGATCATT-GATGAATGTTCCTCGTTGTG D_rerio300070 TGC-AGAGAGATGATTCAATTCATGTGCTCTGGATCATT-GATGAATGTTCCTCGTTGTG D_rerio300071 TGC-AGAGAGATGATTCAATTCATGTGTTCTGCATCATT-GATGAATGTTCCTCGTTGTG D_rerio300072 TGC-AGAGAGGTGATTCAATTCATGTGTTCTGGATCATT-GATGAATATTCCTCGTTGTG D_rerio300073 TGC-AGATAGATGATTCAATTTATTTGCTCTGGATCATT-GGTGAATGTTTCTCGTTGTG D_rerio300182 TAC-AGAGAGATGATTTAATTCATATTCTCTGTATCTTT-GATGAATGTTCCTTGTTGTG D_rerio300231 TAA-TAATCAATGGGTAAAC-CATGGATAAT-TATCATT-GATGACCGTTCTACGGTTCT D_rerio300242 TGC-AGAGAGATGATTCAATTCATGTGCTCTGGATCATT-GATGAATGTTCCTCGTTGTG D_rerio300243 TGC-AGAGAGATGATTCAATTCATGTGCTCTGGATCATT-GATGAATGTTCCTCGTTGTG D_rerio300244 TGC-AGAGAGATGATTCAATTCATGTGCTCTGGATCATT-GATGAATGTTCCTCGTTGTG D_rerio300245 TGC-AGAGAGATGATTCAATTCATGTGCTCTGGATCATT-GATGAATGTTCCTCGTTGTG D_rerio300297 TGC-AGAGAGATGATTCAATTCATGTGCTCTGGATCATT-GATGAATGTTCCTCGTTGTG D_rerio300298 TGC-AGAGAGATGATTCAATTCATGTGTTCTGGATCATT-GATGAATATTCCTCGTTGTG D_rerio300299 TGC-AGAGAGGTGATTCAATTCATGTGTTCTGGATCATT-GATGAATATTCCTCGTTGTG D_melanogaster300016 TTT--GCCCAGTGTTCTT-TGTG-GTGCCTCGCATCGTT--CGGGACGCAGGGCTTCGAT D_melanogaster300017 TTT--GCCCAGTGTTCTT-TGTG-GTGCCTCGCATCGTT--CGGGACGCAGGGCTTCGAT D_melanogaster300037 TTT--GCCCAGCACCCTTGTGGG-ATGCACTGCATCCTTAGCGGGGAGCGGGGCTTCGAT H_sapiens300112 CTTTCTGGCGTTGCTTGGCTGCAACTGCCGTCAGCCATT-GATGATCGTTCTTCTCTCCG H_sapiens300182 CTTTCTGGCGTTGCTTGGCTGCAACTGCCGTCAGCCATT-GATGATCGTTCTTCTCTCCG H_sapiens300243 CTTTCTGGCGTTGCTTGGCTGCAACTGCCGTCAGCCATT-GATGATCGTTCTTCTCTCCG H_sapiens300250 CTTTCTGGCGTTGCTTGGCTGCAACTGCCGTCAGCCATT-GATGATCGTTCTTCTCTCCG H_sapiens300448 CTTTCTGGCGTTGCTTGGCTGCAACTGCCGTCAGCCATT-GATGATCGTTCTTCTCTCCG H_sapiens300723 CTC-CTGGTGTTGGTTGGCCGCAACTGCCATTTGCCATT-GATGATCATTCTTCTCTTCC * * D_rerio300020 TAAAGCAGTTTTGGAG-GAAAAGAGCCTGAACTGAGCGGC- D_rerio300021 TAACACAGTTTTGGAG-GAAAAGAGCCTGAACTGAGTGGT- D_rerio300022 TAAAGCAGATTTGGAG-GAAAAGAGCCTGAACTGAGCGGC- D_rerio300023 CAAAGCAGTTTTGGAG-GAAAAGAGCATGAACTGAGCAGC- D_rerio300024 TAACACAGTTTTGGAG-GAAAAGAGCATGAACTGAGCGGC- D_rerio300025 TAAAGCAGTTTTGGAG-GAAAAGAGCCTGAACTGAGCGGC- D_rerio300026 CGAAGCAGTTTTGGAG-GAAAAGATCATGAACTGAGCAGC- D_rerio300027 TAACACAGTTTTGGAG-GAAAAGAGCATGAACTGAGCGGC- D_rerio300028 TAAAGCAGTTTTGGAG-GAAAAGAGTATGAACTGAGCGGC- D_rerio300036 TAAAGCAGTTTTGGAG-GAAAAGAGCCTGAACTGAGCGGC- D_rerio300037 TAACACAGTTTTGGAG-GAAAAGAGCATGAGCTGAGCGGC- D_rerio300038 CGAAGCAGTTTTGGAG-GAAAAGATCATGAACTGAGCAGC- D_rerio300039 TAACACAGTTTTGGAG-GAAAAGAGCATGAACTGAGCGGC- D_rerio300041 TAATG-AATCTAAGAG-GAGGAGTGCACGAACAGAGTGGT- D_rerio300047 TTTTACAACATAGGAG-GAAAAGAGTATAAACTGAGTGGA- D_rerio300048 TCTTACAAAATAGGAG-GAAAAGAGTATGAACTGAGTGGTT D_rerio300049 TCTTACAACATAGGAG-GAAAAGAGTACAAATTGAGTGGT- D_rerio300051 TCATACAACAAAGGAG-GAAAAGAGTATGATCTGAGTGGTT D_rerio300052 TCTTACAACATAGGAG-GAAAATAGTATGATCTGAGTGGTT D_rerio300053 TCTTACAACATAGGAG-GAATAGAGTATGAACTGAGTGGT- D_rerio300054 AGCTG------------------------------------ D_rerio300055 TCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGC- D_rerio300066 TCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGC- D_rerio300068 TCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGC- D_rerio300069 TCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGC- D_rerio300070 TCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGCT D_rerio300071 TCTCACAACAGAGAAG-GAAAAGAGTATGAGCAGAGTGGC- D_rerio300072 TCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGC- D_rerio300073 TCTCACAGCAGAGGAC-GAAAAGAGAATGAGCAGAGTGGC- D_rerio300182 TCTTACAGCATAGGAG-GAAAAGAGTATGAACTGAGTGGAT D_rerio300231 TATCG-GACCTAAGAG-GAGGAGTGCACGAACAGAGTGGT- D_rerio300242 TCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGC- D_rerio300243 TCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGC- D_rerio300244 TCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGC- D_rerio300245 TCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGC- D_rerio300297 TCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGC- D_rerio300298 GCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGC- D_rerio300299 TCTCACAACAGAGGAG-GAAAAGAGTATGAGCAGAGTGGC- D_melanogaster300016 GATCGCTCGGTAGAAACGGATAGAGCGAATTCTGAGTGGT- D_melanogaster300017 GATCGCTCGGTAGAAACGGATAGAGCGAATTCTGAGTGGT- D_melanogaster300037 GATCGCTCGGTTTGAACGGATAGAGCGAATTCTGAGTGGT- H_sapiens300112 TATTGGGGAGTGAGAG-GGAGAGAACGCGGTCTGAGTGGT- H_sapiens300182 TATTGGGGAGTGAGAG-GGAGAGAACGCGGTCTGAGTGG-- H_sapiens300243 TATTGGGGAGTGAGAG-GGAGAGAACGCGGTCTGAGTGG-- H_sapiens300250 TATTGGGGAGTGAGAG-GGAGAGAACGCGGTCTGAGTGG-- H_sapiens300448 TATTGGGGAGTGAGAG-GGAGAGAACGCGGTCTGAGTGG-- H_sapiens300723 TGTGGTAGAGGAAGAG-GGAGAGAATGCAGTTTGAGTGG--

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved