snOPY snoRNA Orthological Gene Database

Family: SNORD38

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300170 ----------GGCAGTGATGATTAAA---ACCAGTTCTGCTTCAGATAAT A_thaliana300171 -GGGATGATGAATTGTAACAGCTTGATACGCCAGTTCTGCTTCAGATAAT A_thaliana300172 TGGGATGATGAATTGTAACAGCTTGATACGCCAGTTCTGCTTCAGATAAT C_elegans300029 --GAATCTCAGACGGGGAAAGTTAATCTTCACAATAACTCAGTAGCAGAA C_familiaris300433 ------TCTTGGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTT C_familiaris300434 -----CTTCTTATGATGAAAACT---G--TCCAGTTCTGCTACTGAAAGG C_porcellus300936 ------TCTTAATGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTC D_novemcinctus300067 -----CTTCTTGTGATGAAAACT---CTGTCCAGTTCTGCTTCTGAAGGG D_novemcinctus300257 ------ACTCAGTGATGAAAACT---TAGTCCAGTTCTGCTACTGACTGT D_novemcinctus300485 ------ACTCAGTGATGAAAACT---TTGTCCAATTTTGCTACTGACTTT D_melanogaster300151 ----------TAACATGATGATGA--TTTTTCAGTTCTGCTACTGAAGAC E_telfairi300829 -----CTTCTTGTGATGAGAACT---CTGTCCAGTTCTGCTACTGAAGGG E_telfairi300830 ------TCTCAATGATGAAACCT---TTGTCCAGTTCTGCTACTGATTTG E_caballus300286 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTGCTGACTTG E_caballus300287 -------CCTTGTGATGAAAA-----CTGTCCAGTTCTGCTGCTGAAGGG F_catus300272 -----CTTCTTATGATGAAAACT---GCGTCCAGTTCTGCTGCTGAAGGG G_gallus300102 -----CTTCTAATGATGATACTT---CTGTCCAGTTCTGCTACTGAAGGG G_gallus300103 -----CTTCTGGTGATGAGACCT---TTGTCCAGTTCTGCTACTGA-ATT G_aculeatus300016 ------TTTCAATGAAGATAACT---T----CAGTTCTGCTACTGAATGA G_aculeatus300017 ------TTTCAATGAAGATAACT---T----CAGTTCTGCTACTGAATGA G_aculeatus300018 ------TTTCAATGAAGATAACT---T----CAGTTCTGCTACTGAATGA G_aculeatus300132 ------TTTCTATGATGATAACT---TTGTTCAGTTCTGCTACTGATTGC H_sapiens300610 ------TGTCAGTGATGAAAATT---TTGTCTAGTTCTGCTACTGACATT H_sapiens300663 ------TTCTCGTGATGAAAACT---CTGTCCAGTTCTGCTACTGAAGGG H_sapiens300664 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACAGT L_africana300338 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTT M_mulatta300437 ------TCTCAGTGATGAAAACT---TTGTCAAGTTATGCTACTGACATT M_mulatta300484 ------TCTTAGTTATGAAAACT---TTGTCCAGTTCTGCTACTGACTTT M_mulatta300580 -------TCTCGTGATGAAACCT---CTGTCCAGTTCTGCTACTGAAGGG M_mulatta300581 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACAGT M_mulatta300598 ------TCTCAGTGATGAAAATT---TTGTCCAGTTCTGCTACTGACATT M_murinus300449 -----CTTCTTATGATGAAAGCT---TAGTCCAGTTCTGCTACTGAAGGG M_murinus300450 ------TCTCAGTGATGAAAACA---TTGTCCAGTTCTGCTACTGACTTT M_domestica300074 ----TCTCCTAGTGATGAGAACC---CTGTCCAGTTCTGCTACTGAGGCT M_domestica300075 -----CTTCTGATGAGGAGAACC---TTGTCCAGTTCTGCTACTGATGTA M_musculus300108 ----------TTTTATGAAAAAT---GTG-CCAGTTCTGCTGCTGACCTC M_musculus300954 ------TCTCGGTGATGAGAACT---TTGTCCAGTTCTGCTGCTGATCTC M_musculus300955 -----CTTCTTGTGATGAAAATA---CTGTCCAGTTCTGCTACTGAAGG- M_lucifugus300736 -------TCTTGTGATGAAATT----CCGTCCAGTTCTGCTACTGAATGG M_lucifugus300737 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTT O_anatinus304515 -----CTTCACGTGATGATAATA---TTGTCCAGTTCTGCTACTGAAGGG O_cuniculus300460 ------GCCTTGTGATGAGACT----CTGTCCAGTTCTGCTACTGAAGGG O_cuniculus300461 ------TCTCCGTGATGAGAACT---TTGTCCAGTTCTGCTACTGATTTG O_latipes300085 ------TTTCAGTGATGATAACT---TTGACCAGTTCTGCTACTGAATGG O_latipes300086 ------TTTCTGTGAAGATAACT---TTGTCCAGTTCTGCTACTGAATAT O_garnettii300257 ------TTATTTTGATGAAAACT---CCATCCAGTTCTGCTACTGAAGGG O_garnettii300465 -------TCTTAGGAAGAAAATT---CTGTTCATTTCTGCTAGTGAAGGG O_garnettii300688 -----CTTCTTGTGATGAAAAAAA--CTGTCCAGTTCTGCTACTGAAGGG O_garnettii300722 ------TCTCAAAAATGTCACAG---TTCCCCAGTTCTGCCACTGAAGGC P_troglodytes300277 ------TCTTAGTGATGAAAACT---TTGTCCAGTTCTGCTAATGACTTT P_troglodytes300397 ------TGTCAGTGATGAAA-CT---TTGTCAAGTTATGCTACTCACATG P_troglodytes300523 -------TCTCGTGATGAAAACT---CTGTCCAGTTCTGCTACTGAAGGG P_troglodytes300524 ------TCTCAGTGATGAAAATT---TTGTCCAGTTCTGCTACTGACAGT P_troglodytes300628 ------TGTCAGTGATGAAAATT---TTGTCTAGTTCTGCTACTGACATT P_pygmaeus300054 ------TCTCAGTGATGAAA-CT---TTGTCAAGTTATGCTACTGACATG P_pygmaeus300198 ------TCTTAGTGATGAAAACT---TTGTCCAGTTCTGCTAATGACTTT P_pygmaeus300594 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACAGT P_pygmaeus300595 -------TCTCGTGATGAAAACT---CTGTCCAGTTCTGCTACTGAAGGG P_pygmaeus300719 ------TCTCAGTGATGAAAATT---TTGTCCAGTTCTGCTACTGACATT R_norvegicus300910 ------TCTCAGTGATGAGAACT---TTGTCCAGTTCTGCTGCTGACTTC R_norvegicus300911 -----CTTCTTGTGATGAAAATA---CTGTCCAGTTCTGCTACTGAAGG- S_cerevisiae300025 ---CTACAATGATGATAAAATTTA--CTATTCAGTTCTGCTTCTGAACCA S_araneus300073 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTG S_araneus300779 ------TATCAATGATGAAAACT---TTGTCCAGTTCTGCTGTTGACTTG S_araneus301049 -----CTTCTTGTGATGATAACT---CTGTCCAGTTCTGCTACTGAAGGG S_araneus301050 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTG S_tridecemlineatus300292 -------TCTTGTGATGAAAACT---CTGTCCAGTTCTGCTGCTGAAGGG S_tridecemlineatus300293 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTG T_nigroviridis300143 ------TTTCAGTGATGATAACT---TTGTCCAGTTCTGCTACTGAATGA T_belangeri300369 -------TCTCGTGATGAAAACT---CTGTCCAGTTCTGCTACTGAAGGG T_belangeri300370 ------TCTCCATGATGAAAACT---TCGTCCAGTTCTGCTACTGACTTT X_tropicalis300101 --------CTTCTGATGATAACC---TTGTCCAGTTCTGCTACTGAAACT X_tropicalis300102 -----CTTCTGCTGATGATAACT---TTGTCCAGTTCTGCTACTGAAATT X_tropicalis300103 -----CTTCTGCTGATGATAACT---TTGTCCAGTTCTGCTACTGAAATT X_tropicalis300104 -----CTTCTGCTGATGATAACC---TTGTCCAGTTCTGCTACTGAGACT * * * A_thaliana300170 T-CCTGATCGAAGAAACTGTATACCAA--AAAACTTCTGAGC-------- A_thaliana300171 T-CTTGATCGAAAAAGCTGTATTCTTATCCGAGCC--------------- A_thaliana300172 T-CTTGATCGAAAAAGCTGTATTCTTATCCGAGCCTTTCATTGCTATTTT C_elegans300029 C-TGGATATCACATCACCG-ATTC-------------------------- C_familiaris300433 A-AAGTGACGATAAAGTAT-AT-CTGAGGAGA------------------ C_familiaris300434 A-AAGAGATGAAAGCCTTTAGTGCTGAGGAAG------------------ C_porcellus300936 A-A-GTGCTGATAAAGTAT-AT-CTGACAAGA------------------ D_novemcinctus300067 A-AAGAGATGAA-GCATTTAGTGCTGAGGAAG------------------ D_novemcinctus300257 A-A-GTGACAATAAAGTATTAC-CTGAGGAGA------------------ D_novemcinctus300485 A-A-GTGATGATAAAGTATTAT-CTGAGGAGA------------------ D_melanogaster300151 A--GTTGACGAAAGCA-AAAATACCAAAATCACTGAAA------------ E_telfairi300829 A-GAGAGATGA--GTCTTTAGTGCTGAGGAAG------------------ E_telfairi300830 A-C-TTGTTGATAAAGTATTGT-CTGAGGAGA------------------ E_caballus300286 --AAGTGATGATAAAGTCT-AT-CTGAGAAGA------------------ E_caballus300287 G-GAGAGATGAAAGCCTTTAGTGCTGACGAAGG----------------- F_catus300272 A-AAGAGATGAAAGCTTTTAGTGCTGAGGAAG------------------ G_gallus300102 A-GAGCGATGACACTTGT-GATGCTGAGGAAG------------------ G_gallus300103 T-GAGGGATGACTGTTTGGAGATCTGAAGAGG------------------ G_aculeatus300016 A--AGTGATGAAAATG-AAGAC--TGAGAAA------------------- G_aculeatus300017 A--AGTGATGAAAATG-AAGAC--TGAGAAA------------------- G_aculeatus300018 A--AGTGATGATAATG-AAGAC--TGAGAAA------------------- G_aculeatus300132 A--AATGGTGATAATACGACAC-CTGAGTAAG------------------ H_sapiens300610 A--AGTTATGATAAAGTCT-GT-CTGAGGAGA------------------ H_sapiens300663 A-GAGAGATGAGAGCCTTTTAGGCTGAGGAA------------------- H_sapiens300664 A--AGTGAAGATAAAGTGT-GT-CTGAGGAGA------------------ L_africana300338 A-C-TTGATGATAAAGTATTAT-CTGAGGAGA------------------ M_mulatta300437 A--AGTGATGATAAAGTGT-GT-CTGAGGAGA------------------ M_mulatta300484 A-A-GTGATGATAAACTAT-GT-CTGAGGGGA------------------ M_mulatta300580 A-GAGAGATGAGAGCCTTT-AGGCTGAGGAA------------------- M_mulatta300581 A--AGTGACGATAAAGTGT-GT-CTGAGGAGA------------------ M_mulatta300598 A--ACTGATGATAAAGTAT-GT-CTGAGAAGA------------------ M_murinus300449 A-GAGAGATGAAAGCTTTTAATGCTGAAGAAG------------------ M_murinus300450 A-A-GTGACGATAAAGTAT-GT-CTGAGGAGA------------------ M_domestica300074 G-A-GTGACGACAGAGGTTTGT-CTGAAGAGA------------------ M_domestica300075 T-CAGAGATGACAGCTTTGTGTGCTGAAGAAG------------------ M_musculus300108 T-AAGTGAGGATGAAG-TGTAT-CTGAGGAGA------------------ M_musculus300954 TTAAGTGAGGATGAAG-T-TAT-CTGAGGAGA------------------ M_musculus300955 A-ATGAGATGAACA-CTTTAGTGCTGAAGAAG------------------ M_lucifugus300736 A-AAGAGAAGAAAGCCTTTAGTGCTGAGGAA------------------- M_lucifugus300737 A-A-GTGGTGATAAAGTAC-AT-CTGAGGAGA------------------ O_anatinus304515 A-CAGCGGTGACACCCTTAGAATCTGAAGAAG------------------ O_cuniculus300460 A-GAGAGATGAAAGCCTTGAGTGCTGAGGAAGGC---------------- O_cuniculus300461 G-AAGTGAGGATAAAG-TACAC-CTGAGGAGA------------------ O_latipes300085 A--AGTGGTGATATTC-AAG-TTCTGAGAAA------------------- O_latipes300086 A--AGAGATGA-ATTTTAACACTCTGAGAAA------------------- O_garnettii300257 A-GAGAGATGAAAGCTTTTAATGCTGAGGCAA------------------ O_garnettii300465 A-GAGAGATGAATGCTTTTAATGCTGAAGA-------------------- O_garnettii300688 A-GAGAGATGAAAGCTTTTAATACTGAGGAAG------------------ O_garnettii300722 A-GAGAGATGAAAGCTTTTAATACTGAGGGGA------------------ P_troglodytes300277 A-A-GTGATGATAAACTAT-GT-CTGAGGGGA------------------ P_troglodytes300397 A--AGTAATGATACAGTAT-AT-CTGAGGAGA------------------ P_troglodytes300523 A-GAGAGATGAGAGCCTTTTAGGCTGAGGAA------------------- P_troglodytes300524 A--AGTGAAGATAAAGTGT-GT-CTGAGGAGA------------------ P_troglodytes300628 A--AGTGATGATAAAGTCT-GT-CTGAGGAGA------------------ P_pygmaeus300054 A--AGTAATGATACAGTAT-AT-CTGAGGAGA------------------ P_pygmaeus300198 A-A-ATGATGATAAACTAT-GT-CTGAGGGGA------------------ P_pygmaeus300594 A--AGTGAAGATAAAGTGT-GT-CTGAGGAGA------------------ P_pygmaeus300595 A-GAGAGACGAGAGCCTTTTAGGCTGAGGAA------------------- P_pygmaeus300719 A--AGTGATGATAAAGTCT-GT-CTGAGGAGA------------------ R_norvegicus300910 T-AAGTGAGGATGAAG-TGTAT-CTGAGGAGA------------------ R_norvegicus300911 A-ATGAGATGAATA-CTTTAGTGCTGAAGAAG------------------ S_cerevisiae300025 AAATAATAGGAAGATAACCAATTTTACCAAAGCTCAAATCTGATT----- S_araneus300073 A-AAGTGACGATAAAGTGT-AT-CTGAGGAGA------------------ S_araneus300779 G-AAGTTATGATAAAGTAT-AT-CTGAGA--------------------- S_araneus301049 A-AAGCGATGAA-GCCTATAGATCTGAGGAAG------------------ S_araneus301050 A-AAGTGACGATAAAGTGT-AT-CTGAGGAGA------------------ S_tridecemlineatus300292 A-AAGAGATGAATGCCTTTAATGCTGAGGAGG------------------ S_tridecemlineatus300293 A-A-GTGATGATAAAATGT-AT-CTGAGGAGA------------------ T_nigroviridis300143 A--AGTGGTGATAGCA-AAGACTCTGAGAA-------------------- T_belangeri300369 A-AAGTGATGAAAGCCTTTAATGCTGAGGAA------------------- T_belangeri300370 T-CAGTGATGATGAAG-TGTGT-CTGAGGAGA------------------ X_tropicalis300101 A-T-GCGATGATATTTCT-GAATCTGAAGAAG------------------ X_tropicalis300102 A-T-GTGGTGATATTTGT-CAACCTGAAGAAG------------------ X_tropicalis300103 A-T-GTGGTGATATTTGT-CAACCTGAAGAAG------------------ X_tropicalis300104 G-T-ACGATGATATTCCT-TAATCTGAAGAAG------------------ * A_thaliana300170 --------------- A_thaliana300171 --------------- A_thaliana300172 GTCTTTCTTCTGAGT C_elegans300029 --------------- C_familiaris300433 --------------- C_familiaris300434 --------------- C_porcellus300936 --------------- D_novemcinctus300067 --------------- D_novemcinctus300257 --------------- D_novemcinctus300485 --------------- D_melanogaster300151 --------------- E_telfairi300829 --------------- E_telfairi300830 --------------- E_caballus300286 --------------- E_caballus300287 --------------- F_catus300272 --------------- G_gallus300102 --------------- G_gallus300103 --------------- G_aculeatus300016 --------------- G_aculeatus300017 --------------- G_aculeatus300018 --------------- G_aculeatus300132 --------------- H_sapiens300610 --------------- H_sapiens300663 --------------- H_sapiens300664 --------------- L_africana300338 --------------- M_mulatta300437 --------------- M_mulatta300484 --------------- M_mulatta300580 --------------- M_mulatta300581 --------------- M_mulatta300598 --------------- M_murinus300449 --------------- M_murinus300450 --------------- M_domestica300074 --------------- M_domestica300075 --------------- M_musculus300108 --------------- M_musculus300954 --------------- M_musculus300955 --------------- M_lucifugus300736 --------------- M_lucifugus300737 --------------- O_anatinus304515 --------------- O_cuniculus300460 --------------- O_cuniculus300461 --------------- O_latipes300085 --------------- O_latipes300086 --------------- O_garnettii300257 --------------- O_garnettii300465 --------------- O_garnettii300688 --------------- O_garnettii300722 --------------- P_troglodytes300277 --------------- P_troglodytes300397 --------------- P_troglodytes300523 --------------- P_troglodytes300524 --------------- P_troglodytes300628 --------------- P_pygmaeus300054 --------------- P_pygmaeus300198 --------------- P_pygmaeus300594 --------------- P_pygmaeus300595 --------------- P_pygmaeus300719 --------------- R_norvegicus300910 --------------- R_norvegicus300911 --------------- S_cerevisiae300025 --------------- S_araneus300073 --------------- S_araneus300779 --------------- S_araneus301049 --------------- S_araneus301050 --------------- S_tridecemlineatus300292 --------------- S_tridecemlineatus300293 --------------- T_nigroviridis300143 --------------- T_belangeri300369 --------------- T_belangeri300370 --------------- X_tropicalis300101 --------------- X_tropicalis300102 --------------- X_tropicalis300103 --------------- X_tropicalis300104 ---------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved