snOPY snoRNA Orthological Gene Database

Family: SNORD36

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300330 --AAGTAAATTTTCTAAGTGTCTGATGATGAAT-TTCATAGGGCAGATTC C_porcellus300826 --ATAAATGTTTTCTAAGTGTCTAATGATGAGT-TTCATAGGGCAGATTC D_novemcinctus300520 ------AAATTTTCCAAGTGTCTACTGATGAAT-TTCATAGGGCAGATTC E_caballus300260 --AAATAAGTTTTCTAAGTGTCTGATGATGAAT-TTCATAGGGCAGATTC E_europaeus300341 --AAATTAGATTTTTAAGTGTCTAATGATGAAT-TTCATAGGGCAGATTC F_catus300308 --AAATAAGTTTTCTAAGTGTCTAATGATGAAG-TTCATAGGGCAGATTC H_sapiens300575 ------AAGTTTTCTAAGTGTCTAATGATGAAT-TTCATAGGGCAGATTC L_africana300518 --AAATAAGTTTTCTTAGTGTCTAATGATGAAT-TTCATAGGGCAGATTC M_mulatta300677 --TTATAAGTTTTCTAAGTGTCTAATGATGAAT-TTCATAGGGCAGATTC M_murinus300523 --AAATAAGTTTTCTAAGTGTCTAATGATGAAT-TTCATAGGGCAGATTC M_domestica300120 --TTTTGAGTTTTCTAAGTGTCTCATGATGAAATTTCATAGGGCAGATTC M_musculus300974 -AAATAATGTTTT-TAAGTGTCTAGTGATGAAT-TTCATAGGGCAGATTC O_anatinus304529 --AATTAAAGTGCTAAAGTGTCTAATGATGAGGACTCATAGGGCAGATTC O_cuniculus300436 --AATTAAGTTTTCCAAGTGTCTCATGATGAAT-TTCATAGGGCAGATTC O_cuniculus300469 AGAATGAGGTGTTTCCTGTGTT--ATGATGAAT-TTCAGAGGGCAGATTC P_troglodytes300572 --TTATAAGTTTTCTAAGTGTCTAATGATGAAT-GTCA--GGGCAGATTC R_norvegicus300941 --AATAATGTTTTCTAAGTGTCTAGTGATGAAT-TTCATAGGGCAGATTC S_araneus300890 --AAATAAGTTTTTAAAGTGTCTAATGATGAAT-TTCATAGGGCAGATTC S_tridecemlineatus300314 --GAATATGTTTTCTAAGTGTCTAATGATGAGT-TTCATAGGGCAGATTC T_belangeri300295 --AATTAAGTTTTCTAAGTGTCTGATGATGAAT-TTCATAGGGCAGATTC **** ****** *** ********** C_familiaris300330 TGAGGTGAAAATTGTATTCATCATTGATAGTCCTATTATGGAATCTGAAG C_porcellus300826 TGAGGTGAAAATTTAGTTCATCATTGATACTCTTTCTATGGAATCTGAAG D_novemcinctus300520 TGAGGTGAAA-TTTAATTCATCATTGATACTCCTACTGTGGAATCTGAAG E_caballus300260 TGAGGTGAAAATTTAATTCATCACTGATAGTCCTACTATGGAATCTGAAG E_europaeus300341 TGAGATGAAAATTAAATTCATCACTGATACTTCTACTGTGAAATCTGAAG F_catus300308 TGAGGTGAAAATTTCATTCATCACTGATACTCCT-CTATGGAATCTGAAG H_sapiens300575 TGAGGTGAAAATTTAATTCATCACTGATACTCCTACTGTGGAATCTGAAG L_africana300518 TGAGGTGAAAATTTAATTCATCATTGATACTCCTACTATGGAATCTGAAG M_mulatta300677 TGAGGTGAAAATTTAATTCATCACTGATAGTCCTACTATGGAATCTGAAG M_murinus300523 TGAGGTGAAAATGTAATTCATCATTGATACCGCTACTATGGAATCTGAAG M_domestica300120 TGAGATGGGAATTGAATTCATCACTGATAAATATTCTGTGAAATCTGAAG M_musculus300974 TGAGGTGAAAATTTAGTTCATCATTGATTGTCCTATTATGAAATCTGAAG O_anatinus304529 TGAGGTGAGCACTGAACTCATCACTGATAATTGTTTGATGCGATCTGAAG O_cuniculus300436 TGAGGTGAAAATTTAGTTCATCGTTGATACCCCTACTATGGATTCTGAAG O_cuniculus300469 TGATGTGAAACTTTAATTCATCATTGATATCC-TACTATGGATTCTCAAG P_troglodytes300572 TGAGGTGAAAATTTAATTCATCACTGATACTCCTACTATGGAATCTGAAG R_norvegicus300941 TGAGGTGAAAATTTAATTCATCATTGATTGTCCTATTATGAAATCTGAAG S_araneus300890 TGAGATGAAAATTGAATTCATCACTGATACTTGTACTGTGAAATCTGAAG S_tridecemlineatus300314 TGAGATGAAAATTTACTTCATCATTGATACTCCTACTATGAAATCTGAAG T_belangeri300295 TGAGGTGAAAACTTAATTCATCATTGATCCTCCTACTATGGAATCTGAAG *** ** ***** **** * ** *** *** C_familiaris300330 ACACTTGGAAACCG C_porcellus300826 ACACTTCAAACCTA D_novemcinctus300520 ACACTTGAAAACCT E_caballus300260 ACGCTTGAAAATCT E_europaeus300341 ACACTTGAAAAACT F_catus300308 ACACTTGAAAACCT H_sapiens300575 ACACTTGAAAACGT L_africana300518 ACACTTGAAAACCT M_mulatta300677 ACACTTGAAAACCT M_murinus300523 ACACTTGAAAACCT M_domestica300120 ACACATGAAAAACT M_musculus300974 ACACTTGAAAACTA O_anatinus304529 ACACTTGAAAGTCT O_cuniculus300436 ACACTTGAAAACCT O_cuniculus300469 ACACTAGAAAAAAA P_troglodytes300572 ACACTTGAAAACCT R_norvegicus300941 ACACTTGAAAACTA S_araneus300890 ACACTTAAAAACCT S_tridecemlineatus300314 ACACTTGAAAACCT T_belangeri300295 ACACTTGAAAGCAT ** * **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved