snOPY snoRNA Orthological Gene Database

Family: SNORD36

CLUSTAL W (1.83) multiple sequence alignment A_tauschii300450 ----------GTCAAATGGTGCTAAAACAAG--ATATTCCTGAGATTTTC C_elegans300038 ---------AAGCAAATGACGAA---ATCGCACCTCGGCCCGACTCCAA- C_familiaris300094 ------------AGGATTATAAACTTTAACAAGTCTCACCTGGAATCT-- C_familiaris300325 ---------TTGACAATGATGCA---GGAATTTCTTCACCTGGAATCT-- C_familiaris300326 ---------TTGCCAATGATGGT-TACGAATTTCTTCACCTGAACCAGC- C_porcellus300911 ----------TTGCAATGATGT-----GAATCTCTCA--CTGAATTAC-- C_porcellus300912 ---------TTGCCCATGATGGT-TAAGAATTTCTTCACCTGAATAAGC- D_rerio300114 ----------CTGCAATGATGTC--TTGAATTTCTTCACCTGAATTCA-- D_rerio300115 ----------CAGCTATGATGT--C-TGAATTTCTTCACCTGAACAA--- D_novemcinctus300279 ------------TTGAAAGAGATGGCAAGAATTCCAAAAATGGACCTC-T D_novemcinctus300283 ----------TTGCAATGATGT-----GAATCTCTCA--CTGAATCAA-- D_novemcinctus300284 ---------TTGCCAGTGATGGT-TAAGAATTTCTTCACCTGAACAAAA- D_novemcinctus300334 -------TTGCCACAAATGCCTATATTAAAAAAACAAAGCAAAAAAAAAA D_melanogaster300127 TTGCCTGTAATGAGACCAAATTGGCCTGGTCGAATTCGAATGTGTCTGGG E_telfairi300083 ----------TTGCCATGATGA-----CAGTCATTCC--CTGAATTAA-- E_telfairi300084 ---------TTGCCGATGATGGT-TAAGAATTTCTTCACCTGAATACAT- E_caballus300265 ---------TTGGCGATGATGCA---TGAATTTCTTCACCTGGAATCA-- E_caballus300266 ----------TTGCGATGATGT-----GAGTTTTTCA--CTGAATTAA-- E_caballus300267 ---------TTGCCGGTGATGGT-TGCGAATTTCTTCACCTGAATAAAC- E_europaeus300240 ---------ATGCCAATGATGGT-TAAGAATTTCTTCACCTGAATAAGC- E_europaeus300529 ---------TTGCCAATGATGGT-TAAGAATTTCTTCACCTGAATAAAC- E_europaeus300702 ---------TTGACAATGATGCA---TGAATTTCTTCATCTGCAACCA-- E_europaeus300703 ----------TTGCAATGATGT-----AAGTTCCTTT--CTGAATAAG-- E_europaeus300704 ---------TTGCCAATGATGGT-TAAGAATTTCTTCACCTGAATAAAC- F_catus300237 ----------TGGCAGTGATGTA---TGAATTTCTTCACCTGGAAACA-- F_catus300238 ----------TTGCAATGATGT-----GGATTTCTCA--CTGAATTCA-- F_catus300239 ---------TTGCCGATGATGGT-TACGAATTTCTTCACCTGAATAAGC- F_catus300146 ---------------TTGCAATGAAGATATA--TTG-TATTGAATGATCT G_gallus300054 -------------------------------------------------- G_gallus300113 ---------------ATGTAAATGATG-AAA--CTAGCACTTTATTTCAA G_gallus300053 -------------------------------------------------- G_aculeatus300128 ----------ATGCAATGATGA--CATGAATTTCTTCAACTGACAAC--- G_aculeatus300129 ----------TAGCAATGATGT---TTGAATTTCTTCACCTGAATCAT-- G_aculeatus300130 ----------ATGCAATGATGA--CACTAATTTCTTTAACTGAAACC--- G_gorilla300976 ----------TTGCAGTGATGTA----AAATTTCTTCACCTGAAATTA-- G_gorilla300977 ---------TTGCCAATGATGGT-TAAGAATTTCTTCACCTGAATAAAC- G_gorilla300975 ----------TTGCAATGATGT-----GAATCTCTGA--CTGAATTCA-- H_sapiens300581 ----------TTGCAGTGATGTA----AAATTTCTTGGCCTGAAATTA-- H_sapiens300582 ----------TTGCAATGATGT-----GAATCTCTCA--CTGAATTCA-- L_africana300451 ---------TTGCCAATGATGGT-TAAGAATTTCTTCACCTGAACAAAC- L_africana300450 ---------TTGGCGATGATGAT---GATAATTTTTCACCTGAAGTGA-- M_mulatta300422 -----------AAGAGAAGTATGTTGGGGAGTTGCCCACTTTGAAATAAA M_mulatta300450 ---------TAGCCTACAATGAA-TTGGTCTTTTCTTAGATTAACAAGC- M_mulatta300458 ----------TTGTAATGATGT-----GAATCTCTCA--CTGAATTCA-- M_mulatta300459 ----------TTGTAATGATGT-----GAATCTCTCA--CTGAATTCA-- M_mulatta300672 ----------TTGCAATGATGT-----GAATCTCTCA--CTGAATTCA-- M_mulatta300673 ----------TTGCAGTGATGTA----GAATTTCTTCGCCTGAAATCA-- M_mulatta300671 ---------TTGCCAGTGATGGT-TAAGAATTTCTTCACCTGAATAAAC- M_murinus300069 ---------TTGCCAATGATGGT-TAAGAATTTCTTCACCTGAATAAAC- M_murinus300475 ----------------------TAGATTGTG--TTGATAATATAATTTCA M_murinus300068 ---------------ATGATGC-----GAATCTCTTA--CTGAACTAA-- M_domestica300125 ----------TTGCAATGATGTA---TGAATTTCTTCACCTGAAATAAC- M_domestica300126 ----------TTGCAATGATGTG--T-GAATTTCTTCACCTGAATTAAT- M_musculus300969 ---------TTGCCAGTGATGCT-TAGGAATTTCTTCACCTGAATCAAC- M_musculus300967 ----------GTGCAGTGATGTG---TGAATTTCTTCACCTGAAAATA-- M_musculus300968 ----------TTGCAATGATGT-----CAATCTTTGA--CTGAAGTGA-- M_lucifugus300770 ----------TTGCAATGATGT-----GAATTTCTTA--CTGAATTAA-- M_lucifugus300771 ---------TTGCCGATGATGGT-GACGAATTTCTTCACCTGAATAAAC- O_anatinus302278 ----------TAAAAGTGGTGTA---TGAATTTCTTCACCAGAAATAA-- O_anatinus302459 ----------TTGCAATGATGTA--T-GAATTTCTTCACCTGAA---AA- O_sativa300106 ----------GCCAAATGATGCTAAAATATG--TTTTTGCTGAGTCTTTC O_sativa300108 ---------GAGCAGATGATGATATATTATG--TTTGTACTGATTTATT- O_sativa300239 ----------GCCAAATGATGCTAAAATATG--TTTTTGCTGAGTCTTTC O_sativa300240 ---------GAGCATGTGATGTTACAAGGAG--ATGCTACTGAGATGTTA O_latipes300058 ----------ATGCAATGATGT--TCAGAATTTCTTCACCTGAAACT--- O_latipes300059 ----------TGGCAATGATGT---CTGAATTTCTTCACCTGAATCCT-- O_garnettii300612 ----------CTGCAATGATGTAC---AAATGTCTTCACCTGAAATCA-- O_garnettii300613 ----------TTGCAATGGTGT-----AAATCTCTCA--CTGAATTAATT O_garnettii300614 ---------TTGCCAATGATGGT-TAAGAATTTCTTCACCTGAATAAAC- P_troglodytes300578 ----------TTGCAGTGATGTA----AAATTTCTTCGCCTGAAATTA-- P_troglodytes300579 ----------TTGCAATGATGT-----GAATCTCTCA--CTGAATTCA-- P_troglodytes300580 ---------TTGCCAATGATGGT-TAAGAATTTCTTCACCTGAATAAAC- P_patens300046 ---------------GTGTACATGATGCGAA--CCAACTATGTATCCTAT R_norvegicus300935 ----------GTGCAATGATGTG---TGAATTTCTTCACCTGAAATCA-- R_norvegicus300936 ----------TTGCAATGATGT-----GAATCTTTTG--CTGAAGTGA-- R_norvegicus300937 ---------TTGCCAATGATGGT-TAAGAATTTCTTCACCTGAATCAAC- R_norvegicus300489 ----------GTGCAGAGATGTG---TGCGTTTCTTCACCTGAAGTCA-- S_araneus300514 ---------TTGCCCGTGATGGT-TAAGAATTTCTTCACCTGAATCGTC- S_tridecemlineatus300256 ----------TTGCAATGATGC-----AAGCCTTTTG--CTGAATTAG-- S_tridecemlineatus300257 ---------TTGCCTATGATGGT-TAAGAATTTCTTCACCTGAATGAAT- S_tridecemlineatus300255 -------------GTGCTATGA---TGCATCAGTTTCACCCGAAATCA-- T_nigroviridis300038 ---------------------A--CTTGAATTTCTTCACCTGATGGC--- T_nigroviridis300039 -----------TGCAATGATGTT--T-GAATTTCTTCACCTGAAGTCA-- T_belangeri300417 ---------GTTGCGATGATGTA---TGAATTTCTTCACCTGAAAC---- T_belangeri300418 ----------TTGCGATGATGT-----GACTTTTCCA--CTGAAGTGA-- X_tropicalis300137 ---------TCGCAATGATGTA--ATTGAATTTCTTCACCTGACTGG--- X_tropicalis300138 ----------TTGCAGTGATGG---CTGAATTTCTTCACCTGAAACCAC- X_tropicalis300136 ----------GTGCAATGATGTGCATAGAATTTCTTCACCTGAATGA--- A_tauschii300450 T----TTGAGGAA--TA---CAAAATCAAGCT-TTTTAAAACTGATGGTT C_elegans300038 ---CCCTGGGGGCGAAAT---------GAGCT-TTTTAACTCAGATGCTT C_familiaris300094 ---CTGTGAAGCATAAAA------TC-AAGCT-TTTTAACCCTGAGTCAC C_familiaris300325 ---CTGTGAAGAGTAAAA------TC-GAGCT-TTTTAACCCTGAGTCAC C_familiaris300326 ---CA-TGTGGTC------------ATACTGT-ATCTGAGGCAAA----- C_porcellus300911 --GCCATGAGGTGTGAAT-----CCATGAGCT-TTTTAACCCTGAGCAGT C_porcellus300912 ---CA-TGTGGTC------------ATGCTTT-ATCTGAGGCAAA----- D_rerio300114 ---AACTGAAGATCAAAA------TACGAGCT-TTTTAACCCTGAGCAAC D_rerio300115 ---CCATGTGGTTTAAA---------TGAGCT-TTTTAACCCTGAGCTAA D_novemcinctus300279 GAATAATAATGA----AA--AATGATAGAGCT-TTTTAACATTGAAACAA D_novemcinctus300283 --ACCGTGAAGTGCAAAT-----CTATGAGCT-TTTTAACCCTGAGCAAT D_novemcinctus300284 ---CA-TGTGGTC------------ATGTTTT-ATCTGAGGCAAA----- D_novemcinctus300334 AAAAAGTGCAAATCTATGA----------GCT-TTTTAACCCTGAGCAAT D_melanogaster300127 CCCAGTTAAAAGGCAAATTACGCTAATGAAATGTTTTAACCCTGATGTG- E_telfairi300083 --CCCTTGAAGCACAAAC-----ACATGAGCT-TTTTACCCCTGAGCAGC E_telfairi300084 ---CA-TGTGGTC------------GTGTTTT-TTCTGAGGCAAA----- E_caballus300265 ---CCGTGAAGAGTAAAA------TCCGAGCT-TTTTAACCCTGAGTCAT E_caballus300266 --ACCGTGAAGTGCAAAC-----ACATGAGCT-TTTTAACCCTGAGCAAT E_caballus300267 ---CA-TGTGGCC------------ATTTTGT-ATCTGAGGCAAA----- E_europaeus300240 ---CA-TGAGGTC------------ATATTCT-ATCTGAGGCAAA----- E_europaeus300529 ---CA-TGTGGTC------------ATATTCT-ATCTGAGGCAAA----- E_europaeus300702 ---CTGTGGAGAGTGAAA------CC-GAGCT-TTTTAACCCTGAGTCAC E_europaeus300703 --ACCTTGAAGTGCAAA------ATATGAGCT-TTTTAACCCTGAGCAAT E_europaeus300704 ---CA-TGTGGTC------------ATATTCT-ATCTGAGGCAAA----- F_catus300237 ---CCGTGGAGAGCAGAA------TCCGAGCT-TTTTAACCCTGAGCCAC F_catus300238 --ACTTTGAAGTGCAAAA------CATGAGCT-TTTTAACCCTGAGCAGT F_catus300239 ---CG-TGTGGTC------------GTGTTGT-GTCTGAGGCAAA----- F_catus300146 GAGGATCTGTGAT--TGG--ATAATAAGAGCT-TATTAAAACTGATGCCA G_gallus300054 -------------------------------------------------- G_gallus300113 GTCATTTTAAAAT---AG--TAAAATCTAGCT-TTTTAAAACTTAGGCAC G_gallus300053 -------------------------------------------------- G_aculeatus300128 ---CT----GATG-CTT-------T-TGAGCT-TTTTAACCCTGAGCATT G_aculeatus300129 ---CTGTGTGGATC--AA----CCT------T-TTTAAATCCTGAGCAGA G_aculeatus300130 ---CT----GATG-CGT-------T-TGAGCT-TTTTAACCCTGAGCATT G_gorilla300976 ---TTGTGAAGAGTAAAA-------CCGAGCT-TTTTAACACTGAGTCAA G_gorilla300977 ---CA-TGTGGTCAG-----------CATTAC-ATCTGAGGCAAA----- G_gorilla300975 --ACCTTGAAGTGCGAAT-----CCATGAGCT-TTTTAACCCTGAGCAAT H_sapiens300581 ---CTGTGAAGAGTAAAA-------CCGAGCT-TTTTAACACTGAGTCAG H_sapiens300582 --ACCTTGAAGTGCGAAT-----CCATGAGCT-TTTTAACCCTGAGCAA- L_africana300451 ---CA-TGTGGTC------------AAGTTTT-ATCTGAGGCAAA----- L_africana300450 ---CCATGAGGGGTGAA--------TTGAGCT-TTTTAACACTGAGTCAC M_mulatta300422 AATTGACAAAATCTCATGAC------AGAGCT-TTTTAACCCTGATTCTT M_mulatta300450 ---TAGTGAAGTTTTAAA------TACGAGCT-TTTTAAAATAGAGTCTT M_mulatta300458 --ACCTTGAAGTGCAAAT-----CCGTGAACT-TTTTAACCCTGAGCAAT M_mulatta300459 --ACCTTGAAGTGCAAAT-----CCGTGAACT-TTTTAACCCTGAGCAAT M_mulatta300672 --ACCTTGAAGTGCAAAT-----CCATGAGCT-TTTTAACCCTGAGCAAT M_mulatta300673 ---CTGTGAAGAGTAAAA-------CCGAGCT-TTTTAACACTGAGTCAA M_mulatta300671 ---CA-TGTGGTCG-----------ACATTGT-ATCTGAGGCAAA----- M_murinus300069 ---CG-TGTGGTCA------------CATTTT-ATCTGAGGCAAA----- M_murinus300475 GTGGATTTGCAGTGATGT--AAAATTTGAGCA-TTTTAACCCTCAGTCCA M_murinus300068 --ACCTTGAAGTGCAAAT-----ACATGAGCT-TTTTAACCCTGA----- M_domestica300125 ---TTGTGTAGAACAAAT-----ACACGAGCT-TTTTAACCCTGAGGCAT M_domestica300126 --AGCATGAAGAATAAAT-----ACACGAGCT-TTTTAACCCTGAGCAAA M_musculus300969 ---TA-TGTGGTCACA-----------CTGTT-GTCTGAGGCAAA----- M_musculus300967 ---TTGTGAAGAGTAA--------ATCGAGCT-TTTTAACCCTGAGTCGC M_musculus300968 ---CCTTGAAGTGCAATT------ACTGAGCT-TTTTAACCCTGAGCAAT M_lucifugus300770 --TCCTTGAAGTGCAAAT-----ACATGAGCT-TTTTAACCCTGAGCAAT M_lucifugus300771 ---CA-TGTGGTC------------ATGTTGT-GTCTGAGGCAAA----- O_anatinus302278 ---CTGTGGTGATCAAACA---CATTAGATTT-TTTTAAC-CTGAGCTAC O_anatinus302459 --AGAATGAAGAGCAAAT-----ACACGAGCT-TTTTAACCCTGAGCAAA O_sativa300106 T----TTGAAGAC--TAA--CAAAATCGAGCT-TTTTAAAACTGATGGTT O_sativa300108 ------TGATGTC--TA----AAAATCGAGCT-TTTTAAAACTGATGCTC O_sativa300239 T----TTGAAGAC--TAA--CAAAATCGAGCT-TTTTAAAACTGATGGTT O_sativa300240 TATCGTTGAAGTC--TC---TAAAACCGAGCT-TTTTAAAACTGATGCTT O_latipes300058 ---TTCTATGATGGTTT-------T-TGAGCT-TTTTAACCCTGAGCATT O_latipes300059 ---CCGTGTGGATCCAAA----CATACGAGCT-TTTTAACCCTGAGCAGC O_garnettii300612 ---CTGTGGAGAGTAAAA-------TCGAGCT-TTTTAACACTGAGTCAC O_garnettii300613 ACCCTGTGAAGTGCAAAT-----ATGTGAGCT-TTTAAACCCTGAACATC O_garnettii300614 ---TA-TGTGGTCA------------CTTCGT-ATCTGAGGCAAA----- P_troglodytes300578 ---CTGTGAAGAGTAAAA-------CCGAGCT-TTTTAACACTGAGTCAA P_troglodytes300579 --ACCTTGAAGTGCGAAT-----CCATGAGCT-TTTTAACCCTGAGCAAT P_troglodytes300580 ---CA-TGTGGTCAG-----------CATTGC-ATCTGAGGCAAA----- P_patens300046 GCACAGTGAGGAT---TA--AACAAACGAGCT-TTTTAAATCTGATGCAT R_norvegicus300935 ---CCGTGAAGAGTAATTTAAGTAATCGAGCT-TTTTAACCCTGAGTCAC R_norvegicus300936 ---CCTTGAAGTGTAATT------CCTGAGCT-TTTTAACCCTGAGCAAT R_norvegicus300937 ---TA-TGTGGTCATAC--------TCTTCTT-GTCTGAGGCAAA----- R_norvegicus300489 ---CTGT--AGAGTGA-------AACCGAGCT-TTTTGACCCTAAGTCAC S_araneus300514 ---TA-TGTGGTCAGA-----------GTATG-G-CTGAGGCAAA----- S_tridecemlineatus300256 --ACCTTGAAGTGCATATA---TACTTGAGCT-TTTTAACTCTGAGCAAT S_tridecemlineatus300257 ---CA-TGTGGTC------------ATGTTAT-ATCTGAGGCAAA----- S_tridecemlineatus300255 ---CTGTGAGGGTTGAAA------TCCGAGCT-TTTTAACACTGAGTCAC T_nigroviridis300038 ---TTCAGTGATGCGTA-------T-TGAGCT-TTTTAACCCTGAGC--- T_nigroviridis300039 ---CTGTGTAGATCAAAA----CAGACGAGCT-TTTTAACCCTGAGC--- T_belangeri300417 ---CAGTGAAGAGTAAAAA-----TCCGAGCT-TTTTAACACTGAGTCAC T_belangeri300418 ---CCTTGAAGTGCAGAT-----CCATGAGCT-TTTTAACCCTGAGCAGT X_tropicalis300137 ---AT-AATGAAGATTAA----ATC-CGAGCT-TTTTAACCCTGAGCTGT X_tropicalis300138 ---TTGTGTGGATGTAAA----AACACGAGCT-TTTTAACACTGAGCAGT X_tropicalis300136 ---CCGTGTGGCACTCAG----AGC------T-TTTTAACCCTGAGCGGC A_tauschii300450 - C_elegans300038 - C_familiaris300094 A C_familiaris300325 A C_familiaris300326 - C_porcellus300911 - C_porcellus300912 - D_rerio300114 - D_rerio300115 - D_novemcinctus300279 A D_novemcinctus300283 - D_novemcinctus300284 - D_novemcinctus300334 - D_melanogaster300127 - E_telfairi300083 - E_telfairi300084 - E_caballus300265 A E_caballus300266 - E_caballus300267 - E_europaeus300240 - E_europaeus300529 - E_europaeus300702 A E_europaeus300703 - E_europaeus300704 - F_catus300237 - F_catus300238 - F_catus300239 - F_catus300146 G G_gallus300054 - G_gallus300113 G G_gallus300053 - G_aculeatus300128 - G_aculeatus300129 - G_aculeatus300130 - G_gorilla300976 C G_gorilla300977 - G_gorilla300975 - H_sapiens300581 - H_sapiens300582 - L_africana300451 - L_africana300450 A M_mulatta300422 T M_mulatta300450 G M_mulatta300458 - M_mulatta300459 - M_mulatta300672 - M_mulatta300673 - M_mulatta300671 - M_murinus300069 - M_murinus300475 G M_murinus300068 - M_domestica300125 A M_domestica300126 - M_musculus300969 - M_musculus300967 A M_musculus300968 - M_lucifugus300770 - M_lucifugus300771 - O_anatinus302278 - O_anatinus302459 - O_sativa300106 - O_sativa300108 A O_sativa300239 - O_sativa300240 G O_latipes300058 - O_latipes300059 - O_garnettii300612 - O_garnettii300613 - O_garnettii300614 - P_troglodytes300578 - P_troglodytes300579 - P_troglodytes300580 - P_patens300046 C R_norvegicus300935 A R_norvegicus300936 - R_norvegicus300937 - R_norvegicus300489 A S_araneus300514 - S_tridecemlineatus300256 - S_tridecemlineatus300257 - S_tridecemlineatus300255 A T_nigroviridis300038 - T_nigroviridis300039 - T_belangeri300417 A T_belangeri300418 - X_tropicalis300137 - X_tropicalis300138 - X_tropicalis300136 -

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved