snOPY snoRNA Orthological Gene Database

Family: SNORD35

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300128 --GATCTATGATGAGACTT---TCACGACGGTCTTCCGATGTAAT----- C_familiaris300295 -AGCAGAT-GATGGTTTTT-CCTCATGATAGTCTGTGGATGACACTGTGG C_familiaris300346 -TATAGAT-GATGTCTT----CTCACAGTGGTCTTCAGGTGCTCACCCT- C_familiaris300483 -GGCAGAT-GATGTCTT----TTCACGATGGTCTTCAGATGCCCACCGC- C_familiaris300484 -GGCAGAT-GATGGCTCTT-TCTCACGATGGTCTGCGGATGCCACAGTGG C_porcellus300078 -GGCAGAT-GATGTTTATT--CTCACAAGGGTCTTTAGAAGTCCACCCC- C_porcellus300216 -GGCAGATTGATGGCTTTT-TCTCACGATGGTCTGCGGATGTCACTGCG- C_porcellus300819 -GGCAGGT-GATGTCTGTT--CTCACGATGGTCTTCAGAAGCCTGCCAC- D_rerio300103 -TGCAA-ATGATGT-TTTT-TCTCACGATGGTCTTCCAAGTCTGT----- D_rerio300104 -TGCAG-ATGATGT-CTTT--CTCACGATGGTCTTCCTAAACTCTT---- D_rerio300105 -TGCAG-GTGATGT-CTTT-TCTCACGATGGTCTTCTGAACCCTT----- D_rerio300106 -TGCAA-ATGATGT-TTTT-TCTCACGATGGTCTTCCAAGTCTTT----- D_novemcinctus300445 -TGCAGAT-GATGGCTCTT-TCCATGGATAGTCTGGGGATGCCCCTACAG D_novemcinctus300511 -GGCAAGT-GATGTCTGTT--TTCACGATGGTCTTCGGATGCCCACCAC- D_melanogaster300152 -GGCATTCTGATGATAAAA---TCATGACGGTCTTC--ATAAAAC----- D_melanogaster300153 -CATACTCTGATGATAAAA---TCATGACGGTCTTC--ATAAAAC----- E_telfairi300850 -GGCAGGT-GATGGATTAC-TCTCACGATGGTCTGCGGATGCCCGAGCGG E_telfairi300851 -GGCAG-GTGATGTTCTTT-TCTCACGATGGTCTTCGTATGCCCC----- E_caballus300324 -GGCAGAT-GATGGCTTTT-TCTCACGATGGTCTGCGGATGCCACTGTGG E_caballus300325 -GGCAGAT-GATGTCTGTC--CTCACGATGGTGTGCAGATGCCTGCCAC- E_europaeus300058 -CGCAGAT-GATGGTTTGT-TCTCACGATGGTCTGCAATTGCCACTAAAG E_europaeus300273 -GGCAGGT-GATGGTTTAC-TCTCACAATGGTCTGTGAATGCCAGTGAAG E_europaeus300364 -GACAGAT-GGTGGTTTAT-TCTCCTAACGGTCAGTAAATGCCACTGAGG E_europaeus300520 -GGCAGAT-GATGGTTTAT-TCTCACGATGGTCTGCGAATGCCGCTGAAG E_europaeus300552 -GGCAGAT-GATGGCTACT--CTCACGATGGTCTGCAGATGCCCGCGGCT E_europaeus300590 -GGCAGAT-GATGGTTCAT-TCTCACGATGGTCTGCGGATGCCGCCGAGG F_catus300157 -TGCAGAT-GATGTCTCTT-CCTCACGATGGTCTGCGGGTGCCACTGTGG F_catus300293 -GGCAGAT-GATGTCTCTT-TCTCACGATGGTCTGCGGATGCCGCTGCTG F_catus300294 -GGCAGAT-GATGTCAT----CTCACGATGGTCTTCAGATGCCCACCAC- G_gallus300034 -TGGTGGT-GATGTCTGAA--CTCACGATGGTCTTCAGAGTCCCTGTTGG G_gallus300035 -TGCAC-ATGATGC-CATT--CTCACGATGGTCTTCCAAGCCTCAC-GGT G_aculeatus300124 -TACAA-ATGATGT-TTTT--CTCACGATGGTCTTCCAAGCCCTC----- G_aculeatus300125 -TGCAA-ATGATTT-CTTT--CTCACGATGGTCTTCCAAGCCTTC----- H_sapiens300566 -GGCAGAT-GATGTCCTTA-TCTCACGATGGTCTGCGGATGTCCCTGT-- H_sapiens300567 -GGCAGAT-GATGTTTGTT--TTCACGATGGTCTTCAGATGCCCACGT-- M_mulatta300544 -GGCAGAT-GATGTCCTTA-TCTCACGATGGTCTGCGGATGTCCCTGC-- M_mulatta300545 -GGCAGAT-GATGTCGGTT--TTCACGATGGTCTTCAGATGCCCACGT-- M_murinus300423 -GGCAGAT-GATGTCTGTT--TTCACGATGGTCTTCAGATGCCCACCAC- M_murinus300471 -GGCAGAT-GATG--TCTT-TCTCACGATGGTCTGCGGATGCCTCTGTGG M_domestica300157 -GGCAGAT-GATGTTTGT--CATCACGATGGTCTTCGGATGCCTAAGG-- M_domestica300159 -GGCAT-GTGATGG-CTTT-TCTCACGATGGTCTTCAGAGGCTCCC---C M_musculus300752 -GGCAAGT-GATGTCTGTT--CTCACGATGGTCTTCAGATGTCCTCTA-- M_musculus300753 -GGCACAT-GATGTTCTTATTCTCACGATGGTCTTCGGATGCCACAGTTA O_anatinus302218 -GGCAG-ATGATGT-CCAT-TCTCACGATGGTCTTCAGATTGCCCC---- O_anatinus302219 -GGCAG-ATGATGT-CTAT-TCTCACGATGGTCTTCAGATTGCCCC---- O_anatinus303226 -AGCTA-A--AAAT-TTGC-TCTCACTAAGGTCTTCAGATTGCCCC---- O_anatinus303968 -GGCAG-ATGATGT-CCAT-TCTCACGATGGTCTTCAGATTGCCCC---- O_latipes300005 -TGCAA-ATGATGT-TT-T-TCTCACGATGGTCTTCCAAGCC-TT----- O_latipes300089 -TGCAA-ATGATGT-TTCT-TCTCACGATGGTCTTCCAAGCC-TT----- O_garnettii300136 -CGCAGGT-GATGTCCATG--TTCACAATGGTCTTCAGATGCCCAAGTA- O_garnettii300648 -GGCAGAT-GATG-TTTTT--CTCACGATGGTCTGCGGATGCCCTTGT-T O_garnettii300649 -GGCAGGT-GATGTGCATT--TTCACGATGGTCTTCAGATGCCCAACTA- P_troglodytes300609 -GGCAGAT-GATGTCCTTA-TCTCACGATGGTCTGCGGATGTCCCTGC-- P_troglodytes300610 -GGCAGAT-GATGTCTGTT--TTCACGATGGTCTTCAGATGCCCACGT-- P_pygmaeus300081 -GGCAGAT-GATGTCTGTT--TTCACGATGGTCTTCAGATGCCCACGT-- P_pygmaeus300664 -GGCAGAT-GATGTCCTTA-TCTCACGATGGTCTGCGGATGTCCCTGC-- R_norvegicus301078 -GGCATGT-GATGTCTGTT--CTCACGATGGTCTTCAGATGTCCTCCA-- R_norvegicus301079 -GGCAGAT-GATGGTAT-ATTCTCACGATGGTCTTCGGATGCCACAGT-- S_cerevisiae300016 GTTTATGATGATTTCCACA-TTTCACGACGGTCAACTGCGTTTTTCGAAT S_araneus300247 -ATCACTTTGATGGCTCTT-TCTCACAATGGTCTGTGGATGCCACAGTGA S_araneus300496 -ATCACTTTGATGGCTCTT-TCTCACAATGGTCTGTGGATGCCACAGTGA S_araneus300535 -GGCAGAT-GATGGCTCTT-TCTCACGATGGTCTGCGGATGCCACAGTGG S_araneus301047 -GGCATAT-GATGTTTGTA--CTCACGATGGTCTTCAGATGCCCACCTG- S_tridecemlineatus300340 -GGCAAAT-GATG-TTTTT-TCTCACGATGGTCTGCGGATGCCACTGTGT T_nigroviridis300026 -TGCAA-GTGATGT-CTTT--CTCACGATGGTCTTCCAAGC--TC----- T_nigroviridis300027 -TGCAA-ATGATGT--TTT--ATCACGATGGTCTTCCAAACCCTC----- T_nigroviridis300028 -TGCAA-ATGATGT-CTTT--CTCACGATGGTCTTCCTAACCGT------ T_belangeri300134 -GGCAGAT-GATGTCTTTT-TCTCATGATGGCCTATGAATCCTACTGCAA T_belangeri300362 -GGCAGAT-GATGTCTTCT-TCTCACGATGGTCTGCGGATGCCGCTG--G T_belangeri300363 -GGCACAT-GATGTCTGTT--CTCACGATGGTCTTCAGATGCCCACCAA- X_tropicalis300057 -TGCAA-ATGATGT-TTA---CTCACGATGGTCTTCCAAGCCTCACTGGT X_tropicalis300058 --GCAATATGATGT-ATTT-TCTCACGATGGTCTTCCAAGCATTG----- X_tropicalis300059 -TGCAA-ATGATGT-TTAT-ACTCACGATGGTCTTCCAAGCCTCG-TGGT * C_elegans300128 ------ACATACCTG-------TGGATATC-TTTACGTGAAGCTGAGATC C_familiaris300295 G------CAGCAGCGGTAACACCA-ATGG--CTCAGCT-GATGCCAGGAA C_familiaris300346 ----GGGCACTGCTGAGAAAGCCACTTGG--CACAGCT-GATGCCAGAAG C_familiaris300483 ----GGGCACTGCTGAAAAAACCACTTGG--CACAGCT-GATGTCAGCGG C_familiaris300484 G------CAGTGCCGATAATGCCA-ATGG--CTCAGCT-GATGCCAGCAG C_porcellus300078 ----AGGCATGGCTCAGAAAGCTGGCTGG--C-AACACTGATGCCAGAAA C_porcellus300216 -------CAGTGCAGATATCGCCA-AAGG--TTCAGCTAGATGTCAGAAT C_porcellus300819 ----AGGCACTGCTGAGAAAGCTGATTGG--C-AACACTGATGCCAGAAA D_rerio300103 ---CAGGCTCTGACGACACTGCCTTATGG--CATCACT-GAT-GCAGCAA D_rerio300104 -AAAGAGCTCTGAGGAAACTGCCTAATGG--CAATGCT-GAT-GCAGTGG D_rerio300105 ---TGGGTTTTGAGGATGATGCCTTATGG--CTTTACT-GAT-GCTTCCC D_rerio300106 ---CAGGCTCTGACGACATTGCCTTATGG--CATCACT-GAT-GCAGCAG D_novemcinctus300445 G------TGCTGCCAATAATGCCA-ATGG--CTCAGCA-GATGCCAGGAA D_novemcinctus300511 ----GGGCAGTGCCGAGAAATCTGCTCGG--C-AAAGCTGATGCCGGCAG D_melanogaster300152 ------AAATTGCTGAAGAACCTTGACTCT-TCTCAATAAAAATGAGAAT D_melanogaster300153 ------AAATTGCTGAAAGAACTTGACTCT-TTTTACTAAATGTAAAAAT E_telfairi300850 G------CAATGCCGAAAGTGCCA-ATGG--CTCAGCT-GATGCCAGGAA E_telfairi300851 --TGGGGTT-CTGCCGACACTGCCCAAGG--CAATGCT-GATGCCAGTGG E_caballus300324 G------CAGTGCCGATAATGCCA-ATGG--CTTAGCT-GATGCCAGGAG E_caballus300325 ----GGGCACTGCTGAGAAAGCCGCTTGG--C-ACAGCTAATGCCAGAAA E_europaeus300058 G------CGCTGCCGAAAATGCCC-ATGG--CTCAGCT-GATGCCAGGAG E_europaeus300273 G------CGATGCCTAAAATGCCA-ATGG--CTCAGCT-GATGCCAGGAG E_europaeus300364 G------CACTGCCGAAAATGCCA-GTGG--CTCAGCT-GATGCCAGTAG E_europaeus300520 G------CGCTGCCGAAAATGCCA-GTGA--CTCAGCT-GATGCCAGGAG E_europaeus300552 G-----GCACTGCTGAGACGGCCGCTTGG--CGTGGCT-GATGTCGGGCG E_europaeus300590 G------CGCTGCCGAAAATGCCA-GTGG--CTCAGCT-GATGCCAGGAG F_catus300157 G------TAGAGCAGATGATGCCA-ATGG--CCCAGCT-GATGCCAGGAG F_catus300293 G------CAGTGCCGACAACGCCA-ATGG--CTCAGCT-GATGCCAGGAG F_catus300294 ----GGGCACTGCTGAGAAAGCCACTTGG--CACAGCT-GATGTCAGAAG G_gallus300034 T-GAGGGGACTGCTGACAATGCCAGTGGC--AACTGCTGAACCATCAGA- G_gallus300035 GAAGGGGCTGTGACGACAACGCCACATGG--CTTTGCT-GATGCCTGGTA G_aculeatus300124 ---TGGGTGCTGACGACAATGCCTAACGG--CAACACT-GAT-GTATTGG G_aculeatus300125 ---AGGGTTCTGACGATAGTGCCTTTTGG--CAATGCT-GAT-GCAGTCA H_sapiens300566 -----GGGAATGGCGACAATGCCA-ATGG--CTTAGCT-GATGCCAGGAG H_sapiens300567 ----GGGCACTGCTGAGAAAGCCACTTGG--T-AAAACTGATGCCGGAAA M_mulatta300544 -----GGGAATGGCGACAATGCCG-ACGG--CTTAGCT-GATGCCAGGAG M_mulatta300545 ----GGGCACTGCTGAGAAAGCCACTTGG--TTAAAACTGATGCCGGAAA M_murinus300423 ----GGGCACTGCTGAGGAAGCCACTTGG--T-AAAACTGATGCCAGCAA M_murinus300471 G------CAGTGCCGATATCACCA-ATGG--TTCAGCT-GATGCCAGGAC M_domestica300157 -----GTACCTGCCGACAAAGCCACAAGG--CTCAGCT-GATGCCAGGAG M_domestica300159 CTTGGGGTCACTGCTGATCTGCCTCAGGG--CTTAGCT-GATGCCGATGT M_musculus300752 ----GGGCACTGCTGAGACAGCCAGTTGA--C-AAAGCTGATGCCATAAA M_musculus300753 G----GGCAGTGCCGATAATGCCA-AAGG--CTAAGCT-GATGCCAGGAG O_anatinus302218 CCGTGGGCCCTGATGACACCGCCGAAAGG--CTCAGCT-GATGCCAGGGG O_anatinus302219 CCGTGGGCGCTGGCGACACCGCCAAACGG--CTTAACT-GATGCCAGGGG O_anatinus303226 CTGTGGACACTGGTGACACTGCCAAATGG--CTTAGCT-GATGCCAGGAG O_anatinus303968 CCGTGGGCCCTGATGACACCGCCGAAAGG--CTCAGCT-GATGCCAGGGG O_latipes300005 ---CGGGTTCTGACGACATCGCCTTTTGG--CAAAACT-GAT-GCAGGAA O_latipes300089 ---CAGGTTCTGACGACAACGCCTTTTGG--CAGAACT-GAT-GCAGAGA O_garnettii300136 ----GGGCACTGCTGAGAAAAAAAAAAGAATCTCAGTT---TACCAACAT O_garnettii300648 G-----GCAGTGCCGA-AGCACTA-ATAG--TTCAGCT-GATGCCAGGAG O_garnettii300649 ----GGGCACTGCTGAGAAA-CCACTTGG--T-AAAACTGATGCCAGAAA P_troglodytes300609 -----GGGAATGGCGACAATGCCA-ATGG--CTTAGCT-GATGCCAGGAG P_troglodytes300610 ----GGGCACTGCTGAGAAAGCCACTTGG--T-AAAACTGATGCCGGAAA P_pygmaeus300081 ----GGGCACTGCTGAGAAAGCCACTTGG--T-AAAACTGATGCCGGAAA P_pygmaeus300664 -----GGGAATGGCGACAATGCCA-TTGG--CTTAGCT-GATGCCAGGAG R_norvegicus301078 ----GGGCACTGCTGAGACAGCCACTTGG--C-GAAGCTGATGCCATAAA R_norvegicus301079 -----------GCCGATAATGCCA-AAGG--CTGAGCT-GATGCCAGGAG S_cerevisiae300016 GTTTATCGATTAACTTTGATGATATTTCGCCTGTGACAGGGCGTGGTACT S_araneus300247 G------CACTGCAGAGAATGCCA-AAGG--CACAGCT-GATGCTAGGGC S_araneus300496 G------CACTGCAGAGAATGCCA-AAGG--CACAGCT-GATGCTAGGGC S_araneus300535 G------CGCTGCCGAGAATGCCA-AAGG--CACAGCT-GATGCTAGGGC S_araneus301047 ----GGGCATTGCTGAGAAAGCCATTTGG--CACTGCT-GATGTCAGAAT S_tridecemlineatus300340 GTGTGTGCAGTGCCGAGAACGCTA-AAGG--CTTAGCT-GATGCCAGGAG T_nigroviridis300026 ---GATGCTCTGACGACACTGCCTTTGGC--AGACTCT-GAT-GCAGCTT T_nigroviridis300027 ---GGGGTTCTGAGGATACTGCCTCATGG--CAATACT-GAT-GTAGTAA T_nigroviridis300028 ---AGGGTTCTGACGACACCGCCTAACGG--CAACACT-GAT-GCAGTCG T_belangeri300134 G------CAGTCCTGATAATGCCA-ACGG--CTCAGCT-AATGCCAGGAG T_belangeri300362 G------CGGTGCCGAGAATGCCG-ATGG--CTCAGCT-GATGCCAGGGG T_belangeri300363 ----GGGCCCTGCTGAGAAAGCCACTTGG--C-AAGGCTGATGCCAGAAG X_tropicalis300057 GAAGAGGTTTTGACGATATTGCCAAATGG--CTTTACT-GAT-GCTCTGA X_tropicalis300058 ----ATGCTTTGACGAAACTGCCATTTGG--CTTTGCT-GATTGCTGAGC X_tropicalis300059 GAAGAGGTTTTGACGAAAGTGCCAGATGG--CTTTGCT-GAT-GCTTTGC C_elegans300128 --------- C_familiaris300295 --------- C_familiaris300346 --------- C_familiaris300483 --------- C_familiaris300484 --------- C_porcellus300078 --------- C_porcellus300216 --------- C_porcellus300819 --------- D_rerio300103 A-------- D_rerio300104 A-------- D_rerio300105 T-------- D_rerio300106 A-------- D_novemcinctus300445 --------- D_novemcinctus300511 --------- D_melanogaster300152 ACTGATATT D_melanogaster300153 ACTGAAACT E_telfairi300850 --------- E_telfairi300851 --------- E_caballus300324 --------- E_caballus300325 --------- E_europaeus300058 --------- E_europaeus300273 --------- E_europaeus300364 --------- E_europaeus300520 --------- E_europaeus300552 --------- E_europaeus300590 --------- F_catus300157 --------- F_catus300293 --------- F_catus300294 --------- G_gallus300034 --------- G_gallus300035 --------- G_aculeatus300124 C-------- G_aculeatus300125 T-------- H_sapiens300566 --------- H_sapiens300567 --------- M_mulatta300544 --------- M_mulatta300545 --------- M_murinus300423 --------- M_murinus300471 --------- M_domestica300157 --------- M_domestica300159 --------- M_musculus300752 --------- M_musculus300753 --------- O_anatinus302218 --------- O_anatinus302219 --------- O_anatinus303226 --------- O_anatinus303968 --------- O_latipes300005 A-------- O_latipes300089 A-------- O_garnettii300136 --------- O_garnettii300648 --------- O_garnettii300649 --------- P_troglodytes300609 --------- P_troglodytes300610 --------- P_pygmaeus300081 --------- P_pygmaeus300664 --------- R_norvegicus301078 --------- R_norvegicus301079 --------- S_cerevisiae300016 GAGCTTT-- S_araneus300247 --------- S_araneus300496 --------- S_araneus300535 --------- S_araneus301047 --------- S_tridecemlineatus300340 --------- T_nigroviridis300026 C-------- T_nigroviridis300027 A-------- T_nigroviridis300028 G-------- T_belangeri300134 --------- T_belangeri300362 --------- T_belangeri300363 --------- X_tropicalis300057 A-------- X_tropicalis300058 --------- X_tropicalis300059 A--------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved