snOPY snoRNA Orthological Gene Database

Family: SNORD34

CLUSTAL W (1.83) multiple sequence alignment A_tauschii300157 TCTTACCTATGATGAGTTGCGAACTGT---ATTGCCTACATTGTTTGAAC A_thaliana300161 ----GCCAGTGATGATT---GAAAAAG---ATTGTCTACATTGTTTGATG A_thaliana300162 ----GCCTATGATGATT---CAAATT-----TTGCCTACATTGTTTGATA A_thaliana300163 ----GCTGGTGATGATGTTTCATATC----TTTGCCTACATTGCCTGATC A_thaliana300190 --GAGCCAATGATGATT---GAAAAAG---ACTGCCCACATTGTTTGATT C_familiaris300485 TGGCGTCCATGATGTTGCACAGTTGT-------ACCTACATTGTTTGATC D_melanogaster300213 --AGTTCCATGATGTTTTCAAACTCT----ATTACCTACATTATTTGAAC D_melanogaster300214 --CGCGACATGATGAACATTA-CATT----CTTACCTACATTATTTGAAC E_europaeus300589 GGGCGTCCATGATGACCGACCGTT---------ACCTACATTGTTTGACC H_sapiens300565 ---CGTCCATGATGTTCCGCAACT---------ACCTACATTGTTTGATC L_africana300497 CAGCGTCTGTGATGTTCCTTGACT---------ACCTACATTGTTTGATC M_mulatta300543 TGGCGTCTGTGATGTTCCGCAATT---------ACCTACATTGTTTGATC M_murinus300470 CGGCGTCCATGATGTTCTGCGATT---------ACCTACATTGTTTGATC M_musculus300754 -AGCGTCTGTGATGTTCTGCTATT---------ACCTACATTGTTTGAGC M_lucifugus300782 -CGTGTCCGTGATGATCCACGATT---------ACCTACATTGTTTGAAC O_anatinus302222 AAGGGCCGATGATGCTGTTCAATT---------ACCTACATTGTTTGATT O_anatinus302749 AAGGGCCGATGATGCTGTTCAATT---------ACCTACATTGTTTGATT O_garnettii300647 ---CGTCCATGATGTTCTACAATT---------ACCTACATTGTTTGAGC P_troglodytes300608 TGGCGTCTGTGATGTTCCGCAACT---------ACCTACATTGTTTGATC R_norvegicus301080 -AGCGTCTGTGATGTTCTG---TT---------ACCTACATTGTTTGAGC S_cerevisiae300066 ----TTTTATGATGAATTTATGTTTTCAATCTTATCTACATTATCTGAAT S_tridecemlineatus300339 -AGCGTCCATGATGTTACGCAATT---------ACCTACATTGTTTGAGC T_belangeri300361 ---CGTCCGTGATGTTCCACAATT---------ACCTACATTGTTTGACT ***** * ***** *** A_tauschii300157 AATCTG---------TGA---GAAGCTTA-TGCAGCGTCTGAGGATGA-- A_thaliana300161 TACCAC---------TGAAATGAATTCTT-TAATTAGTCTGAGG------ A_thaliana300162 AACCAA---------TGATATAACTTGTA-CAAAATGTTTTCTGAGG--- A_thaliana300163 AAAGCTATTTTTGGCTTTGAACAAGTGAG-TGAATGATAAACTTCTGAAG A_thaliana300190 CACCAC---------TGATATGAATTCTA-TAAAGAGCTTTGTAAGA--- C_familiaris300485 CTC--A---------TGAGAACAGCAT---TGGCTGAGACGCTG------ D_melanogaster300213 GAGAAACCG------TGTAAACAAAACA--TAACTGAGAGG--------- D_melanogaster300214 TAGAAACC-------TGTAACCAACTCT--CAACTGATGCA--------- E_europaeus300589 CTC--C---------TGAGAACAGCTCCT-TGCCTGAGACGCCC------ H_sapiens300565 CTC--A---------TGAAAGCAGCAC---TGGCTGAGACGC-------- L_africana300497 CTC--A---------TGAGAACAGCAC---TGGCTGAGACGCCG------ M_mulatta300543 CTC--A---------TGAAAGCAGCAC---TGGCTGAGACGCCT------ M_murinus300470 CTC--G---------TGAAAACAGCAC---TGGCTGAGACGCCT------ M_musculus300754 CTC--A---------TGAAAACCCCAC---TGGCTGAGACGCCT------ M_lucifugus300782 CTC--A---------TGAGAACAGCAC---TGGCTGAGACACCG------ O_anatinus302222 TTCCTG---------TGAGAAAACAGCTA-TATCTGAGGCCCCT------ O_anatinus302749 TTCCTG---------TGAGAAAACAGCTA-TATCTGAGGCCCCT------ O_garnettii300647 TTC--G---------TGAAAACAACAC---TGGCTGAGACGC-------- P_troglodytes300608 CTC--A---------TGAAAGCAGCAC---TGGCTGAGACGCCA------ R_norvegicus301080 CTC--A---------TGAAAACTGCAC---TGGCTGAGACGCCT------ S_cerevisiae300066 TAATAGC--------TAACAATAGTTATAATGGAAGATATACGACTATCA S_tridecemlineatus300339 CTC--A---------TGAAAACATAAC---TGGCTGAGACGCCT------ T_belangeri300361 CTC--A---------TGAAAACAGCAC---TGGCTGAGACGC-------- * A_tauschii300157 ------------ A_thaliana300161 ------------ A_thaliana300162 ------------ A_thaliana300163 ------------ A_thaliana300190 ------------ C_familiaris300485 ------------ D_melanogaster300213 ------------ D_melanogaster300214 ------------ E_europaeus300589 ------------ H_sapiens300565 ------------ L_africana300497 ------------ M_mulatta300543 ------------ M_murinus300470 ------------ M_musculus300754 ------------ M_lucifugus300782 ------------ O_anatinus302222 ------------ O_anatinus302749 ------------ O_garnettii300647 ------------ P_troglodytes300608 ------------ R_norvegicus301080 ------------ S_cerevisiae300066 ACAATTCTGAAA S_tridecemlineatus300339 ------------ T_belangeri300361 ------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved