snOPY snoRNA Orthological Gene Database

Family: SNORD34

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300161 --GCCAGTGATGAT--TGAA----AAAGATTGTCTACATTGTTTGAT-GT A_thaliana300162 --GCCTATGATGAT--TCAA----ATT--TTGCCTACATTGTTTGAT-AA A_thaliana300163 --GCTGGTGATGATGTTTCA----TATCTTTGCCTACATTGCCTGATCAA A_thaliana300190 GAGCCAATGATGAT--TGAA----AAAGACTGCCCACATTGTTTGAT-TC C_familiaris300485 -TGGCGTCCATGATGTTGCA----CAGTTGTACCTACATTGTTTGATCCT D_melanogaster300213 AGTTCCATGATGTTTTCAAA----CTCTATTACCTACATTATTTGAACGA D_melanogaster300214 CGCGACATGATGAACATTA-----CATTCTTACCTACATTATTTGAACTA E_europaeus300589 -GGGCGTCCATGATGACCGA----CCGTT--ACCTACATTGTTTGACCCT H_sapiens300565 ----CGTCCATGATGTTCCG----CAACT--ACCTACATTGTTTGATCCT L_africana300497 -CAGCGTCTGTGATGTTCCT----TGACT--ACCTACATTGTTTGATCCT M_mulatta300543 -TGGCGTCTGTGATGTTCCG----CAATT--ACCTACATTGTTTGATCCT M_murinus300470 -CGGCGTCCATGATGTTCTG----CGATT--ACCTACATTGTTTGATCCT M_musculus300754 --AGCGTCTGTGATGTTCTG----CTATT--ACCTACATTGTTTGAGCCT O_anatinus302222 -AAGGGCCGATGATGCTGTT----CAATT--ACCTACATTGTTTGATTTT O_anatinus302749 -AAGGGCCGATGATGCTGTT----CAATT--ACCTACATTGTTTGATTTT O_garnettii300647 ----CGTCCATGATGTTCTA----CAATT--ACCTACATTGTTTGAGCTT P_troglodytes300608 -TGGCGTCTGTGATGTTCCG----CAACT--ACCTACATTGTTTGATCCT R_norvegicus301080 --AGCGTCTGTGATGTTCTG-------TT--ACCTACATTGTTTGAGCCT S_cerevisiae300066 --TTTTATGATGAATTTATGTTTTCAATCTTATCTACATTATCTGAATTA S_tridecemlineatus300339 --AGCGTCCATGATGTTACG----CAATT--ACCTACATTGTTTGAGCCT T_belangeri300361 ----CGTCCGTGATGTTCCA----CAATT--ACCTACATTGTTTGACTCT ** * ***** *** A_thaliana300161 ACCA----CTGAAATGAA-TTCTTTAATTAGTCTGAGG------------ A_thaliana300162 ACCA----ATGATATAAC-TTGTACAAAATGTTTTCTGAGG--------- A_thaliana300163 AGCT----ATTTTTGGCT-TTGAACAAGTGAGTGAATGATAAACTTCTGA A_thaliana300190 ACCA----CTGATATGAA-TTCTATAAAGAGCTTTGTAAGA--------- C_familiaris300485 CATG----AGAACAGCA--TTGGCTGAGACGCTG---------------- D_melanogaster300213 GAAACCGTGTAAACAAAACATAACTGAGAGG------------------- D_melanogaster300214 GAAACC-TGTAACCAACTCTCAACTGATGCA------------------- E_europaeus300589 CCTG----AGAACAGCTCCTTGCCTGAGACGCCC---------------- H_sapiens300565 CATG----AAAGCAGCA--CTGGCTGAGACGC------------------ L_africana300497 CATG----AGAACAGCA--CTGGCTGAGACGCCG---------------- M_mulatta300543 CATG----AAAGCAGCA--CTGGCTGAGACGCCT---------------- M_murinus300470 CGTG----AAAACAGCA--CTGGCTGAGACGCCT---------------- M_musculus300754 CATG----AAAACCCCA--CTGGCTGAGACGCCT---------------- O_anatinus302222 CCTGTGAGAAAACAGCT--ATATCTGAGGCCCCT---------------- O_anatinus302749 CCTGTGAGAAAACAGCT--ATATCTGAGGCCCCT---------------- O_garnettii300647 CGTG----AAAACAACA--CTGGCTGAGACGC------------------ P_troglodytes300608 CATG----AAAGCAGCA--CTGGCTGAGACGCCA---------------- R_norvegicus301080 CATG----AAAACTGCA--CTGGCTGAGACGCCT---------------- S_cerevisiae300066 ATAGCTAACAATAGTTATAATGGAAGATATACGACTATCAACAATTCTGA S_tridecemlineatus300339 CATG----AAAACATAA--CTGGCTGAGACGCCT---------------- T_belangeri300361 CATG----AAAACAGCA--CTGGCTGAGACGC------------------ * A_thaliana300161 -- A_thaliana300162 -- A_thaliana300163 AG A_thaliana300190 -- C_familiaris300485 -- D_melanogaster300213 -- D_melanogaster300214 -- E_europaeus300589 -- H_sapiens300565 -- L_africana300497 -- M_mulatta300543 -- M_murinus300470 -- M_musculus300754 -- O_anatinus302222 -- O_anatinus302749 -- O_garnettii300647 -- P_troglodytes300608 -- R_norvegicus301080 -- S_cerevisiae300066 AA S_tridecemlineatus300339 -- T_belangeri300361 --

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved