snOPY snoRNA Orthological Gene Database

Family: SNORD33

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300159 -------------------GAGGAATGAGGATGTAATTCCATACGTCTGCAAATCTGAAA A_thaliana300160 -------------------GAGGGATGAGGATATAATTCCATACGTCTGCAAATCTGAAA D_rerio300126 -----------------TTTGTCAGTGATGTTTTT----CCACAGTA-AGTAT--GAGTT D_rerio300127 -----------------TTTGTCGGTGACGAGCTCGCAACCACAGTTCAGTATTCGAGTT D_melanogaster300020 ------------------CCCAAATTGATGAC--AACTTCATACC----CAAATCAGAGA D_melanogaster300021 ------------------CCTTAATTGATGAC--AACTTCATACT----CAAATCAGAGA D_melanogaster300022 ------------------GCCTTCTTGATGAC--AACTTCATACC----CAACTCAGAAA E_caballus300323 -----------------TCGGCCAGTGATGAGG-A-CTTCTCCCA-CTCGTGTTCGAGTT H_sapiens300564 -------------------GGCCGGTGATGAGA-A-CTTCTCCCA-CTCACATTCGAGTT M_musculus300755 -----------------GCAGCTTGTGATGAG--A-CATCTCCCA-CTCATGTTCGAGTT M_lucifugus300781 -----------------GTGGCCCGTGATGAGG-A-CTTCTCCCA-CTCAAGTTCGAGTT O_anatinus302220 -----------------CCGGCCAGTGATGAGGAA-CATTCACCATCTTTCGTTCGAGTC O_anatinus302221 -----------------TGGGTCTGTGATGATG----ACT-TTCA-CTTTATTTCGAGTC O_anatinus302223 -----------------CCGGCCCGTGATGAGGAA-CATTCACCATCTTTCGTTCGAGTC O_anatinus302224 -----------------CCGGTCTGTGATGACG----ACTGTCCA-CTTTATTTCGAGTC O_anatinus302747 -----------------CGGGCCAGTGATGAGGAA-CATTCACCATCTTTCGTTCGAGTC O_anatinus302748 -----------------TGGGTCTGTGATGATG----ACT-TTCA-CTTTATTTCGAGTC O_anatinus304557 ---------------------CTGGTGATGAGGAA-CATTCATCATCTTTCGTTCGAGTC S_cerevisiae300026 TTATTTGATGAATAGACACCACAATCGTCTTTTTTTTATCCGGCGATGATTCCTTTGGAA T_nigroviridis300068 ----------------GATCGTCTGTGATGTTCTT--AACCACTATA----ATTCGAGTT T_nigroviridis300180 -------------CAAGTCTGTCATTGATGATCTA------TTTGTTTCTTGCTTTAGTT * A_thaliana300159 T--ACAGTGTTGATACAAT---GACATGCACTACCATCTGACCTC-- A_thaliana300160 C--ACAGTGTTGATACAATT--GACATGCACTACCATCTGACCTC-- D_rerio300126 T-AACGACCATGAGTCCAC-TTCA--TGCACTACCAGCTGAGACAAA D_rerio300127 T-AACGACCATGAGAATAC-TTTACGTGCACTACCATCTGAGACAAA D_melanogaster300020 A--ATAATGTTGAAATCTTTTTAACATGCATCACCATCTGAATAA-- D_melanogaster300021 A--ATTATGTTGAAATCCTTTTAACATGCATCACCATCTGAATCA-- D_melanogaster300022 A--ACTATGTTGAAATCTTTTTAACATGCATCACCATCTGATTAA-- E_caballus300323 T-CCCAACCATGAGATGAC-TCCACATGCACTACCATCTGAGGCCGC H_sapiens300564 T-CCCGACCATGAGATGAC-TCCACATGCACTACCATCTGAGGCCAC M_musculus300755 G-CTCGACTATGAGATGAC-TCTACATGCACTACCATCTGAGGCTGT M_lucifugus300781 T-CCCAACCATGAGATGAC-TCCACATGCACTACCATCTGAGGCCAC O_anatinus302220 T-CGCGACTGTGAGACCAA-CTC-CATGCACCGC--TCTGAGGCCTC O_anatinus302221 T-CACGACCTTGAGATCACAGCTCCATGCACTACCATCTGAGACCCC O_anatinus302223 T-TGCGACCGTGAGACCGA-CTC-CATGCACCGC--TCTGAGGCCTC O_anatinus302224 T-CCCGACCTTGAGATCACATCTCCATGCACTACCATCTGAGACCGT O_anatinus302747 T-CGCGACTGTGAGACCAA-CTC-CATGCACCGC--TCTGAGGCCTC O_anatinus302748 T-CACGACCTTGAGATCACAGCTCCATGCACTACCATCTGAGACCCC O_anatinus304557 T-CGCGACCGTGAGTCCAA-CTC-CATGCACTGC--TCTAAGGCCTC S_cerevisiae300026 TATGTGCCATGGATTACAT-----CATGCATCACCATCTGATT---- T_nigroviridis300068 TCAATGACAATGAGACAAC-CCTACATGCACTACCATCTGAGACATC T_nigroviridis300180 T-AGCGACCATTAGAAAAC--TCACATTCACTACCATCTTAGACTTA * * ** * ** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved