snOPY snoRNA Orthological Gene Database

Family: SNORD32,SNORD51

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300178 ----GCAATCAGTGATGAAATTATGTCAAATTCAAT--GATTATACAATGATTAT--TAT A_thaliana300179 --CTGCAATCAGTGATGAAATTATGTCAAATTCAAT--GATTATACAATGATTAT--TAT S_cerevisiae300068 TTTTATGATGAAAATCCATTGTATCCCAATACATATTCGACTAGTCATTGACGATGCTGT ** * * *** *** ** ** ** ** *** ** * * A_thaliana300178 AATCACTAGATCACCATCTTTCGGCTGAGATTGC-- A_thaliana300179 AATCACTAGATCACCATCTTTCGGCTGAGATTGCAG S_cerevisiae300068 CGTAACTT-ATCACCATCTTTCGACTGATT------ * *** ************** ****

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved