snOPY snoRNA Orthological Gene Database

Family: SNORD32

CLUSTAL W (1.83) multiple sequence alignment C_elegans300010 CAGTCGAGGAGGAAAGTTTCCATGCACCACTCTGAAGGATAGTGTGGATTATGGTTCACA C_familiaris300487 CGGTCAGTGATGAGCAACAATCACCATCTTTCGTTTGAGTCTCACG-ACCATGAGAT-CA E_telfairi300848 TGGTCAGTGATGAGCAAAAATCACCATCTTTCGTTTGAGTCTCACG-ACCATGAGAC-CA E_caballus300322 AGGTCGGTGATGAGCAACAATCACCATCTTTCGTTTGAGTCTCACG-ACTGTGAGAT-CA E_europaeus300001 AGGTCGGTGATGAGCAACAATCACCATCTTTTGTTTGAGCCTCACG-GCCATGAGAT-CA E_europaeus300067 AGGCCGGTGGTGAGAAACAATCACCATCTTTCGTTTGAGCCTCACA-GCCATGAGAT-CA E_europaeus300279 CAGTCAGTGATGAGCAACAATCACCATCTTTCATTTGAGCCTCACG-GCCATGAGAT-CA H_sapiens300249 GGATTGGTGATGAGCAACAATCACCATCTTTCGTTTGAGTCTCATG-GCCATGAGAC-CA H_sapiens300563 --GTCAGTGATGAGCAACATTCACCATCTTTCGTTTGAGTCTCACG-GCCATGAGAT-CA L_africana300495 AGGTCAGTGATGAGCAACAAACACCATCTTTCGTTTGAGTCTCACG-ACCATGAGAT-CA M_mulatta300384 GGATCGGTGATGAGCAACAATCACCATCTTTCGTTTGAGTTTCATG-GCCATGAGAC-CA M_mulatta300541 CGGTCGGTGATGAGCAACATTCACCATCTTTCGTTTGAGTCTCACG-GCCATGAGAT-CA M_murinus300149 TGGTCAGTGATGAGCAACAATCACCATCTTTCGTTTGAGTCTCACG-ACCATGAGAT-CA M_murinus300468 AGGTCAGTGATGAGCAACAATCACCATCTTTCGTTTGAGTCTCACG-ACCATGAGAT-CA M_domestica300160 GGGCCGGTGACGAGGAATCTTCACCATCTTTCGTTCGAGTCTCGCG-ACTATGAGAC-CA M_musculus300756 GAGTCCATGATGAGCAACACTCACCATCTTTCGTTTGAGTCTCACG-ACTGTGAGAT-CA M_lucifugus300780 CAGTCCGTGATGAGGAGCAATCACCATCTTTCGTTTGAGTCTCACG-ACCATGAGAT-CA O_cuniculus300164 GTGCCCATGATGAGCTACAATCACCAGCTTTGGGCTGAGTCTCACA-ACCATGAGAT-CA O_garnettii300588 AAGTTAGTAATAAGCAGTAATCACCATCTTTCCTTTGAGTCTCATG-ACCAGGAGAT-CA O_garnettii300693 AGGTCAATGATGAGCAACAATCACCATCTTTCGTTTGAGTCTCACG-ACAATGAGAT-CA P_troglodytes300097 GGATTGGTGATGAGCAACAATGACCATCTTTCGTTTGAGTCTCATG-GCCATGAGAC-CA P_troglodytes300606 AGGTCAGTGATGAGCAACATTCACCATCTTTCGTTTGAGTCTCACG-GCCATGAGAT-CA P_pygmaeus300451 GGATTGGTGATGAGCAACAATCACCATCTTTCGTTTGAGTCTCATG-GCCATGAGAC-CA P_pygmaeus300662 CGGTCAGTGATGAGCAACATTCACCATCTTTCGTTTGAGTCTCATG-GCCATGAGAT-CA R_norvegicus300889 ATGACAGCAATGAGCAATAATCACCATCTTT-----GAGTTTCATG-ACTATGAAGC-CA R_norvegicus301082 GAGTCTGTGATGAGCAATAATCACCATCTTTCGTTTGAGTCTCACG-ACTGTGAGAT-CA * ** * * * * ** C_elegans300010 ATTTACTGAGGCTGT-------------- C_familiaris300487 ACCCCATGCA-CCGCT---CTGAGACCT- E_telfairi300848 ACCC-ATGCA-CCGCT---CTGAGACCT- E_caballus300322 ACCCCATGCA-CCGCT---CTGAGACCA- E_europaeus300001 ACTCCATGCA-CTGCT---CTGAGACCT- E_europaeus300067 ACCCCATGCA-CCGCT---TTGAGACTT- E_europaeus300279 ACCCCATGCA-CCGCT---CTGAGACCT- H_sapiens300249 ACCCCATGCA-CTGCT---CTGAGACCT- H_sapiens300563 ACCCCATGCA-CCGCT---CTGAGA---- L_africana300495 ACCCCATGCA-CCGCT---CTGAGACCT- M_mulatta300384 ACCCCATGCA-CTGCTGCTCTGAGACCC- M_mulatta300541 ACCCCATGCA-CCGCT---CTGAGACCT- M_murinus300149 ACCCCATGCA-CCGCT---CTGAGACCT- M_murinus300468 ACCCCATGCA-CCGCT---CTGAGACCT- M_domestica300160 AACC-ATGCA-CCGCT---CTGAGGCCC- M_musculus300756 ACCC-ATGCA-CCGCT---CTGAGACTC- M_lucifugus300780 ACCCCATGCA-CCGCT---CTGAGACCTG O_cuniculus300164 AACCCATGTAACTGCT---CTGAGACCT- O_garnettii300588 ATCCAAAGGAAAAAAA-----AAGAA--- O_garnettii300693 ACCCCATGCA-CCGCT---CTGAGACCT- P_troglodytes300097 ACCCCATGCA-CTGCT---CTGAGACCT- P_troglodytes300606 ACCCCATGCA-CCGCT---CTGAGACCT- P_pygmaeus300451 ACCCCATGCA-CTGCT---CTGAGACCT- P_pygmaeus300662 ACCCCATGCA-CCGCT---CTGAGACCT- R_norvegicus300889 ACTC-ATGCA-CAACT---CTAAGACCT- R_norvegicus301082 ACCC-ATGCA-CCGCT---CTGAGACTT- * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved