snOPY snoRNA Orthological Gene Database

Family: SNORD31

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300157 -------GAAAGTGATGA-TAAGGAATTGTCGCCCCAGGCTTA--ATCTG A_thaliana300158 -TTTGAGGAAAGTGATGA-TATGAAATTGTCGCCCCAGGCTTA--ATCTG C_elegans300024 ---GTTGTCAG-TGACG--ATATTACTTACCGCCCC-AGGCAT--AGTGT C_familiaris300107 ---CTCACCAG-TGATG--AA-TTCAATACCGCCCC-AGTCTG--ATCAC C_porcellus300576 ---CTCACCAG-GGATG--AAATTGAATACCGCCCCCAGTCTG--ATCAC D_rerio300006 --ATAGGTGTGATGATT--T-TAG-ATTACCGCCCC-AGTCTG--ATTTA D_rerio300013 --ATAGGCATGATGATC--T-TAG-ATTACCGCCCC-AGTCTG--ATTTA D_rerio300225 -TATGGACATGATGAG----TGACTATTACCGCCCC-AGGCTG--AAAAG D_novemcinctus300092 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG--AAAAC D_melanogaster300154 ---CTTACATGATGAT---TTTATTCGTACCGCCCC-AGTCTG--AAGAG D_melanogaster300164 ---TTTTTATGATGAT---TTCGT--ATACCGCCCC-AGTCGG--AGAAA D_melanogaster300165 ---TTTTTGTGATGAT---TTCGT--ATACCGCCCC-AGTCGG--AGAAA D_melanogaster300166 ---ATATTATGATGAT---TAAGG--ATACCGCCCC-AGTCGG--AGAAA E_caballus300028 ---CTCACCAG-TGATG--AG-TTCAATACCGCCCC-AGTCTG--ATTAC E_europaeus300059 ---ATTACTAG-TGATG--AA-TTCATTGCCACCC--AGTCTG--ATCGC E_europaeus300488 ---CAAACTAA-TGATG--AA-TTCACTACTGCCCC-AGTTTA--ATCAC F_catus300027 ---CTCACCAG-TGATG--AA-TGCAATACCGCCCC-AGTCTG--AACAC G_aculeatus300076 ------CTCAAGTGATGAGTTATTTATTACCGCCCCAGTCTGA------G G_aculeatus300077 ATTTTGATGTGATGAG-----TAT---TACCGCCCC-AGTCTG--AGAAT G_aculeatus300103 ---TTGATGTGATGAT-----TAT---TACCGCCCC-AGTCTG--AAAAT G_aculeatus300104 ---TTGATGTGATGAT-----TAT---TACCGCCCC-AGTCTG--ATAAT G_aculeatus300105 ATTTTGATGTGATGAG-----TAT---TACCGCCCC-AGTCTG--AGAAT H_sapiens300163 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG--ATCAA H_sapiens300601 ---ACCACCAG-TGATG--AG-TTGAATACTGCCCC-AGTCTG--ATCAA L_africana300011 ---ATCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG--ATCAC M_mulatta300226 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG--ATCAA M_mulatta300428 ---ATCACCAG-TGATG--AG-ATGAATACTGCCCC-TTTCTG--ATCAA M_murinus300333 ---CTGACCAG-GAATG--AA-TTGTGTACTGTCCC-AGTCTGTGATCGC M_murinus300337 ---TGAACTAG-GAATG--AG-TTGCATACTGCCCC-AGTGTGTGATCAC M_murinus300361 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG--ATCAC M_domestica300066 ---CCCACCAG-TGATG--AG-ACGATTACCGCCCC-AGGCTG--ATTCC M_musculus300715 ---CTCACCCT-G-ATG--AA-CTGAATACCGCCCC-AGTCTG--ATAGC M_lucifugus300554 ---CTCACCAG-TGATG--AG-T-TTATACCGCCCC-AGTCTG--ATCAC O_anatinus302951 --AATATTCTG-TGATG--AA--TCTATACCGCCCC-AGTCTG--ATCAT O_anatinus304215 --AATATTCTG-TGATG--AA--TCTATACCGCCCC-AGTCTG--ATCAT O_cuniculus300014 ---CTCACTAG-TGATG--AG-TCTGATACCGCCCC-AGTCTG--ATCAC O_cuniculus300347 ---CTCACTAG-TGATG--AG-TCTGATACCGCCCC-AGTCTG--ATCAC O_latipes300034 ---CAGACGTGATGAG----TTCCTATTACCGCCCC-AGTCTG--AGAAT O_latipes300035 ---CAGAAAGGATGAAG--TTTACTTATACCGCCCC-AGTCTG--AAAGT O_garnettii300315 ---TTTACCAG-TGCTG--AG-TTGAATACCACCCC-AGTCTG--ATAAC O_garnettii300575 ---CTCACCGG-TGATG--AG-TTGAATACCGCCCC-AGTCTG--ATAAC O_garnettii300606 ---GGCACTAG-AAGTTTTAAAAATGCTCCTGGTTCCAGTCTG--ATAAC P_troglodytes300457 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG--ATCAA P_troglodytes300740 ---ACCACCAG-TGATG--AG-TTGAATACTGCCCC-AGTCTG--ATCAA P_pygmaeus300535 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG--ATCAA P_pygmaeus300541 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG--ATCAA P_pygmaeus300716 ---ACCACCAG-TGATG--AG-TTGAATAATGCCCC-TT-CTG--ATCAA R_norvegicus301100 ---CTCACCCT-G-ATG--AA-CTGAATACCGCCCC-AGTCTG--ATAGC S_araneus300141 ---CTCACCAG-TGATG--AA-TTCAATACCGCCCC-AGTCTG--ATCAC S_tridecemlineatus300121 -----TAC-AA-ATATTTCAGCAGTATTACTCAGCCTAGTGAG--ACCAC S_tridecemlineatus300194 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG--ATCAT T_nigroviridis300128 ---CCCACCAAATGATG--AG-TACGTTACCGCCCC-AGTCTG--ATAAC T_nigroviridis300129 ----GAGTCAGATGATG--AGTTA-GTTACCGCCCC-AGTCTG--ATTAT T_belangeri300017 ---CTCACCAG-TGATG--AG-T-TGATACCGCCCC-AGTCTG--ATCAC X_tropicalis300010 ------AAAACCTGATG--AGTTCTATTACCGCCCC-AGTCTG--ATTAT X_tropicalis300013 ---TTCAGCTG-TGATG--AT--CGTATACCGCCCC-AGTCTG--ATGTC * A_thaliana300157 CATCCATTACGATGGTTGTAACATGGTGATTGACTATCTCTGTCTGATTC A_thaliana300158 CATCCATTACGATGGTTGTAACATGGTGATTGACTATTTTTGTCTGATTC C_elegans300024 TTGTGAT---GATTGGT---TTATTCCGAGACTT---------------- C_familiaris300107 C-GTGAC--TGAAAGGT---ATTTTCTGAGCAGTG--------------- C_porcellus300576 T-GTGACA-GAAAAGGT---ATTTTCTGAGTTGAG--------------- D_rerio300006 TC-TGAC--TGATTGGT--ACCCCTCTGAACCTTT--------------- D_rerio300013 TC-TGAC--TGATTGGT--ACCCCTCTGACCTCT---------------- D_rerio300225 TTATGAC--TGATTGGT-ATCCCCTCTGATCCATA--------------- D_novemcinctus300092 T-ATGAC--TGAAAGGT---ATTT-CTGAGCTGTG--------------- D_melanogaster300154 ACGTG-T--TGATTGGTTATTTATACTGATA------------------- D_melanogaster300164 TGATG-T--CGATTGGAATTATTTACTGATT------------------- D_melanogaster300165 TGATG-T--CGATTGGAATAATATACTGATA------------------- D_melanogaster300166 TTATG-T--CGATTGGTTAAACATACTGACT------------------- E_caballus300028 T-GTGAC--TGAAAGGT---ATTCTCTGAGCTGTG--------------- E_europaeus300059 T-GTGAC--TGATAGGT---ATTTCCTGAGCTGTG--------------- E_europaeus300488 T-GTGAC--TGATAGGT---GTTTTCTGAGCTGTG--------------- F_catus300027 T-GTGAC--TGAAAGGT---ATTCTCTGAGCTGTG--------------- G_aculeatus300076 AATTCATGAC--TGATTGGTTCACTCTGATTGAG---------------- G_aculeatus300077 TCATGAC--TGATTGGTTACTCTGATCAAAT------------------- G_aculeatus300103 TCATGAC--TGATTGGTTACTCTGATCAA--------------------- G_aculeatus300104 TCATGAC--TGATTGGTTACTCTGATCAA--------------------- G_aculeatus300105 TCATGAC--TGATTGGTTACTCTGATCAAAT------------------- H_sapiens300163 T-GTGTGACTGAAAGGT---ATTTTCTGAGCTGTG--------------- H_sapiens300601 C-ATGCG--TGAAAGAT---ATTTTCTGAGCTGTG--------------- L_africana300011 T-GTGAC--TGAAAGGT---ATTT-CTGAGCTGTG--------------- M_mulatta300226 T-GTG--ACTGAAAGGT---ATTTTCTGAGCTGTG--------------- M_mulatta300428 T-ATGCG--TGAAAGAT---ATTTTCTGAGCTGTG--------------- M_murinus300333 T-GTAAC--TGAAAGGT---ATTTTCTGAACTGTG--------------- M_murinus300337 T-GTGAC--TGAAAGGT---GTCTTCTGAGCTGTG--------------- M_murinus300361 T-GTGAC--TGAAAGGT---ATTTTCTGAACTGAG--------------- M_domestica300066 T-GTGAC--TGATAGGT----TGTTCTGAGTGGG---------------- M_musculus300715 T-GTGG---AGAAAGGT---ATTTTCTGAGTTGTG--------------- M_lucifugus300554 T-GTGAC--TGAAAGGT---ATTTTCTGAGCTGTG--------------- O_anatinus302951 T-GTGAC--TGAAAGGT---A-ATTCTGAGCTGTC--------------- O_anatinus304215 T-GTGAC--TGAAAGGT---A-ATTCTGAGCTGTC--------------- O_cuniculus300014 T-GTGAC--TGAAAGGT---ATTTTCTGACCTGTG--------------- O_cuniculus300347 T-GTGAC--TGAAAGGT---ATTTTCTGACCTGTG--------------- O_latipes300034 TCATGAC--TGATTGGTTAACCCCTCTGATCTTTG--------------- O_latipes300035 TCATGAC--TGATTGGT-ATCCCCTCTGATCTG----------------- O_garnettii300315 T-GTGAC--TGAAAAGT---ATTTTCTGAACTGAG--------------- O_garnettii300575 T-GTGAC--TGAAAGGT---ATTTTCTGAACTGAG--------------- O_garnettii300606 T---GTGACTGAAAGGT---ATTTTCTGAACTGAA--------------- P_troglodytes300457 T-GTGTGACTGAAAGGT---ATTTTCTGAGCTGTG--------------- P_troglodytes300740 C-ATGCG--TGAAAGAT---ATTTTCTGAGCTGTG--------------- P_pygmaeus300535 T-GTGTGACTGAAAGGT---ATTTTCTGAGCTGTG--------------- P_pygmaeus300541 T-GTGTGACTGAAAGGT---ATTTTCTGAGCTGTG--------------- P_pygmaeus300716 T-AGGCA--TGGAAGAT---ATTTTCTGAGCTGTG--------------- R_norvegicus301100 T-GTGG---AGAAAGGT---ATTTTCTGAGTTGAG--------------- S_araneus300141 T-GTGAC--TGAAAGGT---ATT-TCTGAGCTGTG--------------- S_tridecemlineatus300121 T-ATGTGATAGAAAGGT---ATTTTCTTACCTGTT--------------- S_tridecemlineatus300194 T-GTGAC--AGAAAGGT---ACACTCTGAGTTGTG--------------- T_nigroviridis300128 TCGTGAC--TGATGGGT---ATTTTCTGACTGAA---------------- T_nigroviridis300129 TCATGAC--TGATTGGT--ATCC-TCTGAATAA----------------- T_belangeri300017 T-GTGAC--TGATAGGT---ATTTTCTGAGCTGTG--------------- X_tropicalis300010 CTGTGAC--TGAATGGT---ATCTTCTGA-TTGC---------------- X_tropicalis300013 C-GTGAC--TGAGTGGT---ACAATCTGAGCTGCA--------------- * A_thaliana300157 ------- A_thaliana300158 TCTCAAA C_elegans300024 ------- C_familiaris300107 ------- C_porcellus300576 ------- D_rerio300006 ------- D_rerio300013 ------- D_rerio300225 ------- D_novemcinctus300092 ------- D_melanogaster300154 ------- D_melanogaster300164 ------- D_melanogaster300165 ------- D_melanogaster300166 ------- E_caballus300028 ------- E_europaeus300059 ------- E_europaeus300488 ------- F_catus300027 ------- G_aculeatus300076 ------- G_aculeatus300077 ------- G_aculeatus300103 ------- G_aculeatus300104 ------- G_aculeatus300105 ------- H_sapiens300163 ------- H_sapiens300601 ------- L_africana300011 ------- M_mulatta300226 ------- M_mulatta300428 ------- M_murinus300333 ------- M_murinus300337 ------- M_murinus300361 ------- M_domestica300066 ------- M_musculus300715 ------- M_lucifugus300554 ------- O_anatinus302951 ------- O_anatinus304215 ------- O_cuniculus300014 ------- O_cuniculus300347 ------- O_latipes300034 ------- O_latipes300035 ------- O_garnettii300315 ------- O_garnettii300575 ------- O_garnettii300606 ------- P_troglodytes300457 ------- P_troglodytes300740 ------- P_pygmaeus300535 ------- P_pygmaeus300541 ------- P_pygmaeus300716 ------- R_norvegicus301100 ------- S_araneus300141 ------- S_tridecemlineatus300121 ------- S_tridecemlineatus300194 ------- T_nigroviridis300128 ------- T_nigroviridis300129 ------- T_belangeri300017 ------- X_tropicalis300010 ------- X_tropicalis300013 -------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved