snOPY snoRNA Orthological Gene Database

Family: SNORD29

CLUSTAL W (1.83) multiple sequence alignment A_tauschii300258 ---------GTGCAATGATGATAC--TATTA--CCCAGCTCATTATGAGA A_tauschii300649 ---------TTGCGATGATGATAC--TATTA--CCCAGCTCATTATGAAA A_tauschii300650 ---------TTGCAATGATGATAC--TATTA--CCCAGCTCATTATGAGA A_thaliana300155 ---------TGGCGATGATGATAACATATTA-TCCCAGCTCATTATGAGA C_elegans300114 ---------CCTCGATGACGATTC-AC-CTA-GCTCACTCAGACAT---A C_familiaris300105 ---------TTTCCATGATGAGTC-AAACTA-GCTCACTATGA------C C_familiaris300168 ---------TTTCCATGATGAGTC-AAACTA-GCTCACTATGACCT---T C_porcellus300578 ---------TTTCCATGATGAATT-TAACTA-GCTCACTATGA------- C_porcellus300812 ---------TTTCCATGATGAATT-TAACTA-GCTCACTATGA------- C_porcellus300839 TATCAGTGATGACACTAAATAGCTCACTTTT----AAAAGGATCTT---T D_rerio300224 ---------TCTCTGTGATGAAGA-AACTTA-GCTCACTTTGA------- D_novemcinctus300094 ---------TTTCTATGATGAATC-AAACTA-GCTCACTATGA------C D_melanogaster300155 ---------ACTCAATGATGAAAC---ATTT-ACCCAGCTCGCT-----T D_melanogaster300157 ---------TTAGTATGATGAAAC---ATTT-ACCCAGCTCGCT-----T D_melanogaster300158 ---------TTTGTATGATGAAAC---ATTT-ACCCAGCTCGCT-----T D_melanogaster300160 ---------AAAGTATGATGAAAC---ATTT-ACCCAGCTCGCT-----T E_telfairi300191 ------------CCTTAAAGATGACCCCTTT---AAAAAATACCCT---G E_caballus300030 ---------TTTCTATGATGAAGCAA-ACTA-GCTCACTATGA------C E_caballus300044 --------------ATAATATAAAGACTTTTAATAACTTGTTGAAT---A E_caballus300155 ---------TTTCTATGATGAATC-AAACTA-GCTCACTATGA------C E_europaeus300048 ---------TTTCTATGATGAATC-AAACTA-GCTCACTATGAT-T---A F_catus300172 ---------ATTCTATGATAAATA-AAACTA-GCTCACTATGA------C G_gorilla301040 ---------TTTCTATGATGAATC-AAACTA-GCTCACTATGA------C H_sapiens300165 ---------TTTCTATGATGAATC-AAACTA-GCTCACTATGA------C M_mulatta300224 ---------TTTCTATGATGAATC-AAACTA-GCTCACTATGA------C M_murinus300140 ---------TTAATATGATGAATT-AAACTA-ACTCACTATGA------C M_murinus300363 ---------TTTCTGTGATGAATCAA-ACTA-GCTCACTATGA------T M_domestica300068 ---------TTTCAATGATGAGTC-TAACTA-GCTCACTATGATT----T M_musculus300713 ---------TTTCTATGATGAATC-AAACTA-GCTCACTATGA------C M_lucifugus300552 ---------TTTCTGTGATGAATC-GAACTA-GCTCACTATGA------C O_anatinus302953 ---------TTTCTATGATGATTC-TAACTA-GCTCACTTTGA------T O_cuniculus300023 ---------TTATACTGATGAATCAA-ACTAAAATTAAGAAAT------T O_cuniculus300181 ---------TTTCTGGGATGAATC-AAACTA-GCTCACAATGG------C O_cuniculus300184 ---------TTTCTGGGATGAATC-AAACTA-GCTCACTATGA------- O_cuniculus300345 ---------TTTGTGGGATGAATC-AAACTA-GCTCACTATGA------G O_garnettii300194 ------CTTCTATATTTAAGAAGCAATGGTAAGCACACTATGA------T O_garnettii300248 ---------TTTCTGTGATGAATTAA-ACTA-GCTTACTATGA------T O_garnettii300488 ---------TTTCTGTGATGAATC-AAACTA-GCTCATTATGA------T O_garnettii300573 ---------TTTCTGTGATGAATC-AAACTA-GCTCACTATGA------T P_troglodytes300459 ---------TTTCTATGATGAATC-AAACTA-GCTCACTATGA------C P_pygmaeus300533 ---------TTTCTATGATGAATC-AAACTA-GCTCACTATGA------C P_pygmaeus300616 TATCAGTGATGATACTAAATAGCTCACTTTTTTAAAAAAGAGTCTT---T R_norvegicus301030 ---------TTTCTGTGATGAATC--AACTA-GCTCACTATGACTG---C R_norvegicus301098 ---------TTTCTGTGATGAATC-AA-CTA-GCTCACTATGA------C S_cerevisiae300030 ---------GTTATATGATGATA----ACCT-TCTCAGCTCACTC--AGA S_araneus300245 ---------TTTCTATGATGATTA-AAACTA-GCTCACTTTGA------T S_tridecemlineatus300136 ---------TCATTATGATGAAACT-TACTA-GCTCACCATGCAG---AC S_tridecemlineatus300196 ---------TTTCTATGATGACCCCAAACTA-GCTCACTATGA------T T_nigroviridis300125 ---------GTGCAGTGATGATGA-AACTTA-GCTCACTTTGA------- T_belangeri300233 ---------TTTCTAGGATGAATA-GAAGTA-GCTCACCATGA------C T_belangeri300019 ---------TTTCTATGATGAATA-GAACTA-GCTCACTATGA------C X_tropicalis300011 ---------TTGCTGTGATGAAAC-TAACTA-GCTCACTTTGA------- * A_tauschii300258 CCTCCCTTTGTGGGCAGTCGTGATA-------TGAACTTCTCTTTTGTAT A_tauschii300649 CCTCCCTTTGTGGGTAGTTGTGATA-------TGAACTTCTCTTTTGTAT A_tauschii300650 CCTCCCTTTGTGGGAAGTCATGATA-------TGAACTTCTCTTTTGTAT A_thaliana300155 CCT---TTTGTGGTCAAGGAAAATAA------CTGTTTTCTATAACGTAT C_elegans300114 CAACTGGTGATAAAAAAATTTCGTGTCTTAGAGAC--------------- C_familiaris300105 TTAC--ACAATGAAAATAAGTGAACACCTGAGAAAC-------------- C_familiaris300168 ACAC----AATGAAATATTTTCTTGGTTA--------------------- C_porcellus300578 -CTA--ACTATGAAAACACATGAACACCTGAGAAAC-------------- C_porcellus300812 -CTG--ACTTTTC--ACACATGAACACCTGAGAAAT-------------- C_porcellus300839 TATTTAGTTTTAATGAAAACTTAACTTGAAATAG---------------- D_rerio300224 -CCC--AATGTGAAAAGTCACGAACAACTGAGAGAT-------------- D_novemcinctus300094 TTAC--ACAATGTAAACATAAGAACACCTGAGAAAC-------------- D_melanogaster300155 TGATATTCAATGAAGAGAACTGTTCC---ATATCCAACGCAAAAA--TAA D_melanogaster300157 TGAT-TTCTATGAAGAGAACTGTTCC---ATATCCAACGCAAAAA--TAA D_melanogaster300158 TGAT-TTCTATGAAGAAAACTGTTCC---ATATCCAACGCAAAAAATTAT D_melanogaster300160 TGATATACAATGAAGAGAACTGTTCC---ATATCCAACGCAAAAC--TAA E_telfairi300191 TGATTCTTTTTGGAAATACATGAACACCTAGAGGTC-------------- E_caballus300030 TT----AGAATGAAAACAAGTGAACACCTGAGAAAC-------------- E_caballus300044 TTAGTGTTGCTGAAAAGCATTGAACTCCTGATCAAA-------------- E_caballus300155 TTAC--ACAGTGAAAACATGTGAACACCTGCGAAAC-------------- E_europaeus300048 ATAC----AATGAAGTTGTCACTTTGGCAGATGA---------------- F_catus300172 TTAC--AAAATGAAAGAATGTGAAAA--TGAAGA---------------- G_gorilla301040 TG----ACAGTGAAAATACATGAACACCTGAGAAAC-------------- H_sapiens300165 CG----ACAGTGAAAATACATGAACACCTGAGAAAC-------------- M_mulatta300224 TG----ACAGTGAAAATACATGAACACCTGAGAAAT-------------- M_murinus300140 TGAC--ACAATGAAAATGTGAGCATC--TGATAAAG-------------- M_murinus300363 TG----ACAATGAAAACACGTGAACACCTGAGAAAC-------------- M_domestica300068 ACAT--AAAATGAAAAGGCTTGAACATCTGAGAAAC-------------- M_musculus300713 -TGC---TAATGAAAACACAGGAACACCTGAGAAAC-------------- M_lucifugus300552 GTAC--ATAATGAAAACATTTGAACACCTGAGAAAC-------------- O_anatinus302953 AACT--AAAATGAAAACCCTTGAACATCTGAGAAAC-------------- O_cuniculus300023 TT----AT--TCAAAAGACATGATTATCAGAGTAAA-------------- O_cuniculus300181 TG----ACAGCAAGAACACATGAACACCTGAGAAAC-------------- O_cuniculus300184 -CTG--ATTATGAAAACAGTTGAACACCTAAGGGAA-------------- O_cuniculus300345 TG----ACCATGAAAACACATGAACACCCGAGAAAC-------------- O_garnettii300194 TG----ACAATGAAAATACATGAATACCTGAGAAAC-------------- O_garnettii300248 TG----ACAATGAAAATACATGAATACCTGAGAAAC-------------- O_garnettii300488 TA----ACAAGGAAAATACAGGAACGCCTGGGAAAC-------------- O_garnettii300573 TG----ACAGTGAAAATACACGAACACCTGAGAAAC-------------- P_troglodytes300459 CG----ACAGTGAAAATACATGAACACCTGAGAAAC-------------- P_pygmaeus300533 TG----ACAGTGAAAATACATGAACACCTGAGAAAC-------------- P_pygmaeus300616 TATTTATTTTTAGTAAAAACTTGAGATAG--------------------- R_norvegicus301030 TAAT--GAAAACACTGCTCACTTTTATTTCAGAAAG-------------- R_norvegicus301098 -TGC---TAATGAAAACACTGGAACACCTGAGAAAC-------------- S_cerevisiae300030 TCTTTTGATATGATTGATAAAAATTTCCTATCCAACATTCATCAATTTAT S_araneus300245 TTGC--ACGATGAAAATAAGTGAACACCTGAGGAAC-------------- S_tridecemlineatus300136 TTTCTATCTTTGAATAGTACAGTTG----ATATC-AACAAAAAAATGTG- S_tridecemlineatus300196 TG----ACAATGAAAATATATGAACACCTGAGAAAC-------------- T_nigroviridis300125 -CCC--CATGTGAAACGACAGGAACATCTGAGCATC-------------- T_belangeri300233 TG----ACAATGAAAA--CGTGAACACCTGAGAAAC-------------- T_belangeri300019 TG----AAGATGAAAATACGTGAACACCTGAGAAAC-------------- X_tropicalis300011 -ATA--AAGATGAAAAGTTAAGAACACCTGAGCATC-------------- A_tauschii300258 CTGAGCCCA- A_tauschii300649 CTGAGCATT- A_tauschii300650 CTGAGCCCA- A_thaliana300155 CTGAGCCA-- C_elegans300114 ---------- C_familiaris300105 ---------- C_familiaris300168 ---------- C_porcellus300578 ---------- C_porcellus300812 ---------- C_porcellus300839 ---------- D_rerio300224 ---------- D_novemcinctus300094 ---------- D_melanogaster300155 ACTGCTGACT D_melanogaster300157 CTTGCTGACT D_melanogaster300158 CTTGCTGACT D_melanogaster300160 AATGCTGATT E_telfairi300191 ---------- E_caballus300030 ---------- E_caballus300044 ---------- E_caballus300155 ---------- E_europaeus300048 ---------- F_catus300172 ---------- G_gorilla301040 ---------- H_sapiens300165 ---------- M_mulatta300224 ---------- M_murinus300140 ---------- M_murinus300363 ---------- M_domestica300068 ---------- M_musculus300713 ---------- M_lucifugus300552 ---------- O_anatinus302953 ---------- O_cuniculus300023 ---------- O_cuniculus300181 ---------- O_cuniculus300184 ---------- O_cuniculus300345 ---------- O_garnettii300194 ---------- O_garnettii300248 ---------- O_garnettii300488 ---------- O_garnettii300573 ---------- P_troglodytes300459 ---------- P_pygmaeus300533 ---------- P_pygmaeus300616 ---------- R_norvegicus301030 ---------- R_norvegicus301098 ---------- S_cerevisiae300030 CTGACC---- S_araneus300245 ---------- S_tridecemlineatus300136 ---------- S_tridecemlineatus300196 ---------- T_nigroviridis300125 ---------- T_belangeri300233 ---------- T_belangeri300019 ---------- X_tropicalis300011 ----------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved