snOPY snoRNA Orthological Gene Database

Family: SNORD29

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300155 ------TGGCGATGATGATAACAT--ATTATCCCAGCTCATTATGAGACC C_elegans300114 ---------CCTCGATGACGATTC----AC-CTA-GCTCACTC--AGACA C_familiaris300105 ---------TTTCCATGATGAGTC----AAACTA-GCTCACTA--TGACT C_familiaris300168 ---------TTTCCATGATGAGTC----AAACTA-GCTCACTA--TGACC C_porcellus300578 ---------TTTCCATGATGAATT----TAACTA-GCTCACTA--TGA-- C_porcellus300812 ---------TTTCCATGATGAATT----TAACTA-GCTCACTA--TGA-- C_porcellus300839 TATCAGTGATGACACTAAATAGCTC---ACTTTT----AAAAG--GATCT D_rerio300224 ---------TCTCTGTGATGAAGA----AACTTA-GCTCACTT--TGA-- D_novemcinctus300094 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACT D_melanogaster300155 ---------ACTCAATGATGAAAC--ATTTACCCAGCTCGCT--TTGATA D_melanogaster300157 ---------TTAGTATGATGAAAC--ATTTACCCAGCTCGCT--TTGAT- D_melanogaster300158 ---------TTTGTATGATGAAAC--ATTTACCCAGCTCGCT--TTGAT- D_melanogaster300160 ---------AAAGTATGATGAAAC--ATTTACCCAGCTCGCT--TTGATA E_telfairi300191 ------------CCTTAAAGATGAC---CCCTTT---AAAAAA--TACCC E_caballus300030 ---------TTTCTATGATGAAGC----AAACTA-GCTCACTA--TGACT E_caballus300044 --------------ATAATATAAAG---ACTTTTAATAACTTG--TTGAA E_caballus300155 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACT E_europaeus300048 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGAT- F_catus300172 ---------ATTCTATGATAAATA----AAACTA-GCTCACTA--TGACT H_sapiens300165 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACC M_mulatta300224 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACT M_murinus300140 ---------TTAATATGATGAATT----AAACTA-ACTCACTA--TGAC- M_murinus300363 ---------TTTCTGTGATGAATC----AAACTA-GCTCACTA--TGATT M_domestica300068 ---------TTTCAATGATGAGTC----TAACTA-GCTCACTA--TGATT M_musculus300713 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACT O_anatinus302953 ---------TTTCTATGATGATTC----TAACTA-GCTCACTT--TGA-- O_cuniculus300023 ---------TTATACTGATGAATCA---A-ACTAAAATTAAGA--AATTT O_cuniculus300181 ---------TTTCTGGGATGAATC----AAACTA-GCTCACAA--TGGCT O_cuniculus300184 ---------TTTCTGGGATGAATC----AAACTA-GCTCACTA--TGACT O_cuniculus300345 ---------TTTGTGGGATGAATC----AAACTA-GCTCACTA--TGAGT O_garnettii300194 ------CTTCTATATTTAAGAAGCA---ATGGTAAGCACACTA--TGATT O_garnettii300248 ---------TTTCTGTGATGAATT----AAACTA-GCTTACTA--TGATT O_garnettii300488 ---------TTTCTGTGATGAATC----AAACTA-GCTCATTA--TGATT O_garnettii300573 ---------TTTCTGTGATGAATC----AAACTA-GCTCACTA--TGATT P_troglodytes300459 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACC P_pygmaeus300533 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACT P_pygmaeus300616 TATCAGTGATGATACTAAATAGCTC---ACTTTTTTAAAAAAG--AGTCT R_norvegicus301030 ---------TTTCTGTGATGAATC----AA-CTA-GCTCACTA--TGACT R_norvegicus301098 ---------TTTCTGTGATGAATC----AA-CTA-GCTCACTA--TGACT S_cerevisiae300030 --------GTTAT-ATGATGATA---ACCTTCTCAGCTCACTC--AGATC S_araneus300245 ---------TTTCTATGATGATTA----AAACTA-GCTCACTT--TGATT S_tridecemlineatus300136 ---------TCATTATGATGAAACTTACTAGCTCACCATGCAGACTTTCT S_tridecemlineatus300196 ---------TTTCTATGATGACCCC---AAACTA-GCTCACTA--TGATT T_nigroviridis300125 ---------GTGCAGTGATGATGA----AACTTA-GCTCACTT--TGA-- T_belangeri300019 ---------TTTCTATGATGAATA----GAACTA-GCTCACTA--TGACT T_belangeri300233 ---------TTTCTAGGATGAATA----GAAGTA-GCTCACCA--TGACT X_tropicalis300011 ---------TTGCTGTGATGAAAC----TAACTA-GCTCACTT--TGA-- * A_thaliana300155 TTTTG---TGGTCAAGGAAAATAACTGTT------TTCTATAACGTATCT C_elegans300114 TACAACTGG--TGATAAAAAAATTTCGT-----GTCTTAGAGAC------ C_familiaris300105 TACAC-------AATGAAAATAAGTGAA-----CACCTGAGAAAC----- C_familiaris300168 TTACAC------AATGAAATATTTTCTT-----GGTTA------------ C_porcellus300578 --CTAAC-----TATGAAAACACATGAA-----CACCTGAGAAAC----- C_porcellus300812 --CTGAC-----TTTTC--ACACATGAA-----CACCTGAGAAAT----- C_porcellus300839 TTTATTTAG--TTTTAATGAAAACTTAA-----CTTGAAATAG------- D_rerio300224 --CCCAA-----TGTGAAAAGTCACGAA-----CAACTGAGAGAT----- D_novemcinctus300094 TACAC-------AATGTAAACATAAGAA-----CACCTGAGAAAC----- D_melanogaster300155 TTCAA------TGAAGAGAACTGTTCCATATCCAACGCAAAAA--TAAAC D_melanogaster300157 TTCTA------TGAAGAGAACTGTTCCATATCCAACGCAAAAA--TAACT D_melanogaster300158 TTCTA------TGAAGAAAACTGTTCCATATCCAACGCAAAAAATTATCT D_melanogaster300160 TACAA------TGAAGAGAACTGTTCCATATCCAACGCAAAAC--TAAAA E_telfairi300191 TGTGATTCT--TTTTGGAAATACATGAA-----CACCTAGAGGTC----- E_caballus300030 TAGAA---------TGAAAACAAGTGAA-----CACCTGAGAAAC----- E_caballus300044 TATTAGTGT--TGCTGAAAAGCATTGAA-----CTCCTGATCAAA----- E_caballus300155 TACAC-------AGTGAAAACATGTGAA-----CACCTGCGAAAC----- E_europaeus300048 TAATAC------AATGAAGTTGTCACTT-----TGGCAGATGA------- F_catus300172 TACAA-------AATGAAAGAATGTGAA-----AATGAAGA--------- H_sapiens300165 GACAG---------TGAAAATACATGAA-----CACCTGAGAAAC----- M_mulatta300224 GACAG---------TGAAAATACATGAA-----CACCTGAGAAAT----- M_murinus300140 TGACAC------AATGAAAATGTGAGCA-----TCTGATAAAG------- M_murinus300363 GACAA---------TGAAAACACGTGAA-----CACCTGAGAAAC----- M_domestica300068 TACATAA-----AATGAAAAGGCTTGAA-----CATCTGAGAAAC----- M_musculus300713 GCTAA---------TGAAAACACAGGAA-----CACCTGAGAAAC----- O_anatinus302953 TAACTAA-----AATGAAAACCCTTGAA-----CATCTGAGAAAC----- O_cuniculus300023 TAT-----------TCAAAAGACATGAT-----TATCAGAGTAAA----- O_cuniculus300181 GACAG---------CAAGAACACATGAA-----CACCTGAGAAAC----- O_cuniculus300184 GATTA---------TGAAAACAGTTGAA-----CACCTAAGGGAA----- O_cuniculus300345 GACCA---------TGAAAACACATGAA-----CACCCGAGAAAC----- O_garnettii300194 GACAA---------TGAAAATACATGAA-----TACCTGAGAAAC----- O_garnettii300248 GACAA---------TGAAAATACATGAA-----TACCTGAGAAAC----- O_garnettii300488 AACAA---------GGAAAATACAGGAA-----CGCCTGGGAAAC----- O_garnettii300573 GACAG---------TGAAAATACACGAA-----CACCTGAGAAAC----- P_troglodytes300459 GACAG---------TGAAAATACATGAA-----CACCTGAGAAAC----- P_pygmaeus300533 GACAG---------TGAAAATACATGAA-----CACCTGAGAAAC----- P_pygmaeus300616 TTTATTTAT--TTTTAGTAAAAACTTGA-----GATAG------------ R_norvegicus301030 GCTAA---------TGAAAACACTGCTCACTTTTATTTCAGAAAG----- R_norvegicus301098 GCTAA---------TGAAAACACTGGAA-----CACCTGAGAAAC----- S_cerevisiae300030 TTTTGATATGATTGATAAAAATTTCCTATCCAACATTCATCAATTTATCT S_araneus300245 TGCAC-------GATGAAAATAAGTGAA-----CACCTGAGGAAC----- S_tridecemlineatus300136 ATCTT------TGAATAGTACAGTTG-ATATC-AACAAAAAAATGTG--- S_tridecemlineatus300196 GACAA---------TGAAAATATATGAA-----CACCTGAGAAAC----- T_nigroviridis300125 --CCCCA-----TGTGAAACGACAGGAA-----CATCTGAGCATC----- T_belangeri300019 GAAGA---------TGAAAATACGTGAA-----CACCTGAGAAAC----- T_belangeri300233 GACAA---------TGAAA--ACGTGAA-----CACCTGAGAAAC----- X_tropicalis300011 --ATAAA-----GATGAAAAGTTAAGAA-----CACCTGAGCATC----- A_thaliana300155 GAGCCA-- C_elegans300114 -------- C_familiaris300105 -------- C_familiaris300168 -------- C_porcellus300578 -------- C_porcellus300812 -------- C_porcellus300839 -------- D_rerio300224 -------- D_novemcinctus300094 -------- D_melanogaster300155 TGCTGACT D_melanogaster300157 TGCTGACT D_melanogaster300158 TGCTGACT D_melanogaster300160 TGCTGATT E_telfairi300191 -------- E_caballus300030 -------- E_caballus300044 -------- E_caballus300155 -------- E_europaeus300048 -------- F_catus300172 -------- H_sapiens300165 -------- M_mulatta300224 -------- M_murinus300140 -------- M_murinus300363 -------- M_domestica300068 -------- M_musculus300713 -------- O_anatinus302953 -------- O_cuniculus300023 -------- O_cuniculus300181 -------- O_cuniculus300184 -------- O_cuniculus300345 -------- O_garnettii300194 -------- O_garnettii300248 -------- O_garnettii300488 -------- O_garnettii300573 -------- P_troglodytes300459 -------- P_pygmaeus300533 -------- P_pygmaeus300616 -------- R_norvegicus301030 -------- R_norvegicus301098 -------- S_cerevisiae300030 GACC---- S_araneus300245 -------- S_tridecemlineatus300136 -------- S_tridecemlineatus300196 -------- T_nigroviridis300125 -------- T_belangeri300019 -------- T_belangeri300233 -------- X_tropicalis300011 --------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved