snOPY snoRNA Orthological Gene Database

Family: SNORD29

CLUSTAL 2.0.10 multiple sequence alignment A_thaliana300155 ------TGGCGATGATGATAACAT--ATTATCCCAGCTCATTATGAGACC C_elegans300114 ---------CCTCGATGACGATTC----AC-CTA-GCTCACTC--AGACA C_familiaris300105 ---------TTTCCATGATGAGTC----AAACTA-GCTCACTA--TGACT C_familiaris300168 ---------TTTCCATGATGAGTC----AAACTA-GCTCACTA--TGACC C_porcellus300578 ---------TTTCCATGATGAATT----TAACTA-GCTCACTA--TGA-- C_porcellus300812 ---------TTTCCATGATGAATT----TAACTA-GCTCACTA--TGA-- C_porcellus300839 TATCAGTGATGACACTAAATAGCTC---ACTTTT----AAAAG--GATCT D_rerio300224 ---------TCTCTGTGATGAAGA----AACTTA-GCTCACTT--TGA-- D_novemcinctus300094 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACT D_melanogaster300155 ---------ACTCAATGATGAAAC--ATTTACCCAGCTCGCT--TTGATA D_melanogaster300157 ---------TTAGTATGATGAAAC--ATTTACCCAGCTCGCT--TTGAT- D_melanogaster300158 ---------TTTGTATGATGAAAC--ATTTACCCAGCTCGCT--TTGAT- D_melanogaster300160 ---------AAAGTATGATGAAAC--ATTTACCCAGCTCGCT--TTGATA E_telfairi300191 ------------CCTTAAAGATGAC---CCCTTT---AAAAAA--TACCC E_caballus300030 ---------TTTCTATGATGAAGC----AAACTA-GCTCACTA--TGACT E_caballus300044 --------------ATAATATAAAG---ACTTTTAATAACTTG--TTGAA E_caballus300155 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACT E_europaeus300048 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGAT- F_catus300172 ---------ATTCTATGATAAATA----AAACTA-GCTCACTA--TGACT H_sapiens300165 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACC M_mulatta300224 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACT M_murinus300140 ---------TTAATATGATGAATT----AAACTA-ACTCACTA--TGAC- M_murinus300363 ---------TTTCTGTGATGAATC----AAACTA-GCTCACTA--TGATT M_domestica300068 ---------TTTCAATGATGAGTC----TAACTA-GCTCACTA--TGATT M_musculus300713 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACT O_anatinus302953 ---------TTTCTATGATGATTC----TAACTA-GCTCACTT--TGA-- O_cuniculus300023 ---------TTATACTGATGAATCA---A-ACTAAAATTAAGA--AATTT O_cuniculus300181 ---------TTTCTGGGATGAATC----AAACTA-GCTCACAA--TGGCT O_cuniculus300184 ---------TTTCTGGGATGAATC----AAACTA-GCTCACTA--TGACT O_cuniculus300345 ---------TTTGTGGGATGAATC----AAACTA-GCTCACTA--TGAGT O_garnettii300194 ------CTTCTATATTTAAGAAGCA---ATGGTAAGCACACTA--TGATT O_garnettii300248 ---------TTTCTGTGATGAATT----AAACTA-GCTTACTA--TGATT O_garnettii300488 ---------TTTCTGTGATGAATC----AAACTA-GCTCATTA--TGATT O_garnettii300573 ---------TTTCTGTGATGAATC----AAACTA-GCTCACTA--TGATT P_troglodytes300459 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACC P_pygmaeus300533 ---------TTTCTATGATGAATC----AAACTA-GCTCACTA--TGACT P_pygmaeus300616 TATCAGTGATGATACTAAATAGCTC---ACTTTTTTAAAAAAG--AGTCT R_norvegicus301030 ---------TTTCTGTGATGAATC----AA-CTA-GCTCACTA--TGACT R_norvegicus301098 ---------TTTCTGTGATGAATC----AA-CTA-GCTCACTA--TGACT S_cerevisiae300030 --------GTTAT-ATGATGATA---ACCTTCTCAGCTCACTC--AGATC S_araneus300245 ---------TTTCTATGATGATTA----AAACTA-GCTCACTT--TGATT S_tridecemlineatus300136 ---------TCATTATGATGAAACTTACTAGCTCACCATGCAGACTTTCT S_tridecemlineatus300196 ---------TTTCTATGATGACCCC---AAACTA-GCTCACTA--TGATT T_nigroviridis300125 ---------GTGCAGTGATGATGA----AACTTA-GCTCACTT--TGA-- T_belangeri300019 ---------TTTCTATGATGAATA----GAACTA-GCTCACTA--TGACT T_belangeri300233 ---------TTTCTAGGATGAATA----GAAGTA-GCTCACCA--TGACT X_tropicalis300011 ---------TTGCTGTGATGAAAC----TAACTA-GCTCACTT--TGA-- * A_thaliana300155 TTTTG---TGGTCAAGGAAAATAACTGTT-------TTCTATAACGTATC C_elegans300114 TACAACTG---GTGATAAAAAAATTTCGT-----GTCTTAGAGAC----- C_familiaris300105 TACAC--------AATGAAAATAAGTGAA-----CACCTGAGAAAC---- C_familiaris300168 TTACAC-------AATGAAATATTTTCTT-----GGTTA----------- C_porcellus300578 --CTAAC------TATGAAAACACATGAA-----CACCTGAGAAAC---- C_porcellus300812 --CTGAC------TTTTC--ACACATGAA-----CACCTGAGAAAT---- C_porcellus300839 TTTATTTA---GTTTTAATGAAAACTTAA-----CTTGAAATAG------ D_rerio300224 --CCCAA------TGTGAAAAGTCACGAA-----CAACTGAGAGAT---- D_novemcinctus300094 TACAC--------AATGTAAACATAAGAA-----CACCTGAGAAAC---- D_melanogaster300155 TTCAA------TGAAGAGAACTGTTCCATATCC-AACGCAAAAA--TAAA D_melanogaster300157 TTCTA------TGAAGAGAACTGTTCCATATCC-AACGCAAAAA--TAAC D_melanogaster300158 TTCTA------TGAAGAAAACTGTTCCATATCC-AACGCAAAAAATTATC D_melanogaster300160 TACAA------TGAAGAGAACTGTTCCATATCC-AACGCAAAAC--TAAA E_telfairi300191 TGTGATTC---TTTTTGGAAATACATGAA-----CACCTAGAGGTC---- E_caballus300030 TAG----------AATGAAAACAAGTGAA-----CACCTGAGAAAC---- E_caballus300044 TATTAGTG---TTGCTGAAAAGCATTGAA-----CTCCTGATCAAA---- E_caballus300155 TACAC--------AGTGAAAACATGTGAA-----CACCTGCGAAAC---- E_europaeus300048 TAATAC-------AATGAAGTTGTCACTT-----TGGCAGATGA------ F_catus300172 TACAA--------AATGAAAGAATGTGAA-----AATGAAGA-------- H_sapiens300165 GAC----------AGTGAAAATACATGAA-----CACCTGAGAAAC---- M_mulatta300224 GAC----------AGTGAAAATACATGAA-----CACCTGAGAAAT---- M_murinus300140 TGACAC-------AATGAAAATGTGAGCA-----TCTGATAAAG------ M_murinus300363 GAC----------AATGAAAACACGTGAA-----CACCTGAGAAAC---- M_domestica300068 TACATAA------AATGAAAAGGCTTGAA-----CATCTGAGAAAC---- M_musculus300713 GCT----------AATGAAAACACAGGAA-----CACCTGAGAAAC---- O_anatinus302953 TAACTAA------AATGAAAACCCTTGAA-----CATCTGAGAAAC---- O_cuniculus300023 TAT------------TCAAAAGACATGAT-----TATCAGAGTAAA---- O_cuniculus300181 GAC----------AGCAAGAACACATGAA-----CACCTGAGAAAC---- O_cuniculus300184 GAT----------TATGAAAACAGTTGAA-----CACCTAAGGGAA---- O_cuniculus300345 GAC----------CATGAAAACACATGAA-----CACCCGAGAAAC---- O_garnettii300194 GACA----------ATGAAAATACATGAA-----TACCTGAGAAAC---- O_garnettii300248 GAC----------AATGAAAATACATGAA-----TACCTGAGAAAC---- O_garnettii300488 AAC----------AAGGAAAATACAGGAA-----CGCCTGGGAAAC---- O_garnettii300573 GAC----------AGTGAAAATACACGAA-----CACCTGAGAAAC---- P_troglodytes300459 GAC----------AGTGAAAATACATGAA-----CACCTGAGAAAC---- P_pygmaeus300533 GAC----------AGTGAAAATACATGAA-----CACCTGAGAAAC---- P_pygmaeus300616 TTTATTTA---TTTTTAGTAAAAACTTGA-----GATAG----------- R_norvegicus301030 GCT----------AATGAAAACACTGCTCACTTTTATTTCAGAAAG---- R_norvegicus301098 GCT----------AATGAAAACACTGGAA-----CACCTGAGAAAC---- S_cerevisiae300030 TTTTGATATGATTGATAAAAATTTCCTATCCAA-CATTCATCAATTTATC S_araneus300245 TGCAC--------GATGAAAATAAGTGAA-----CACCTGAGGAAC---- S_tridecemlineatus300136 ATCTT------TGAATAGTACAGTTG-ATATC--AACAAAAAAATGTG-- S_tridecemlineatus300196 GAC----------AATGAAAATATATGAA-----CACCTGAGAAAC---- T_nigroviridis300125 --CCCCA------TGTGAAACGACAGGAA-----CATCTGAGCATC---- T_belangeri300019 GAA----------GATGAAAATACGTGAA-----CACCTGAGAAAC---- T_belangeri300233 GAC----------AATGAAA--ACGTGAA-----CACCTGAGAAAC---- X_tropicalis300011 --ATAAA------GATGAAAAGTTAAGAA-----CACCTGAGCATC---- A_thaliana300155 TGAGCCA-- C_elegans300114 --------- C_familiaris300105 --------- C_familiaris300168 --------- C_porcellus300578 --------- C_porcellus300812 --------- C_porcellus300839 --------- D_rerio300224 --------- D_novemcinctus300094 --------- D_melanogaster300155 CTGCTGACT D_melanogaster300157 TTGCTGACT D_melanogaster300158 TTGCTGACT D_melanogaster300160 ATGCTGATT E_telfairi300191 --------- E_caballus300030 --------- E_caballus300044 --------- E_caballus300155 --------- E_europaeus300048 --------- F_catus300172 --------- H_sapiens300165 --------- M_mulatta300224 --------- M_murinus300140 --------- M_murinus300363 --------- M_domestica300068 --------- M_musculus300713 --------- O_anatinus302953 --------- O_cuniculus300023 --------- O_cuniculus300181 --------- O_cuniculus300184 --------- O_cuniculus300345 --------- O_garnettii300194 --------- O_garnettii300248 --------- O_garnettii300488 --------- O_garnettii300573 --------- P_troglodytes300459 --------- P_pygmaeus300533 --------- P_pygmaeus300616 --------- R_norvegicus301030 --------- R_norvegicus301098 --------- S_cerevisiae300030 TGACC---- S_araneus300245 --------- S_tridecemlineatus300136 --------- S_tridecemlineatus300196 --------- T_nigroviridis300125 --------- T_belangeri300019 --------- T_belangeri300233 --------- X_tropicalis300011 ---------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved