snOPY snoRNA Orthological Gene Database

Family: SNORD28

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300103 GTCAGATGAT--TTGAAT--AGATA-TGCTGA-TCCTCTGTGAGG-TACA D_novemcinctus300096 GTCAAATGAT--TTGAAA--TAATAATGCTGA-TGCTCTGTGAGG-TATG E_caballus300032 GTCAGATGAT--TTGAAT--TGATA-TGCTGA-TCCTCCGTGAGG-TACG E_europaeus300421 GTCAGATGAT--TTGAAT--TTGTT-TGCTGA-TCTCCTGTGAGGCTCAA F_catus300029 GTCAGATGAT--TTGAAT--AGATA-TGCTGA-TCCTCCGTGAGG-TACA H_sapiens300166 GTCAGATGAT--TTGAAT--TGATA-AGCTGA-TGTTCTGTGAGG-TACA M_mulatta300223 GTCAGATGAT--TTGAAT--TGATA-AGCTGA-TGTTCTGTGAGG-TACA M_mulatta300276 TTCAGATGAT--TTGAAC--TGATA-AGCTGA-GGCTCTATGAGG-AATG M_murinus300392 GTCAGATGAT--TTGAAT--TGATA-AGCTGA-TGCTCTGTGAGG-TACA M_domestica300070 GTCAGATGAT--TTGAATCTTGGCT-TACTGA-TGCTCTATGAGGGTCCA M_musculus300712 GTCAGATGAT--TTGAAA--TGATGACACTGAACACTCCGTGAAGGTGTG O_anatinus302955 GCCAGATGAT--TTCAATCCTTATT-TTCTGA-TGCTCCGTGAGG-TACA O_cuniculus300343 GTCAGATGAT--TAGAGC--TGATAAAGCTGA-CGCTTGGTGAAG-TGTG O_garnettii300161 ATCAGATTAT--TTGAAT--GGTTA-AGCTGA-TGTTCTGTGAGG-TACA O_garnettii300444 GTCAGATGAT--TTGAAT--TGATA-TGCTCA-TGCTTTGTGAGG-TATA O_garnettii300731 GTCAGATGAT--TTGAAT--CGGTA-AGCTGA-TGTTCTATGAGG-TACA P_troglodytes300189 TTCAGATGAT--TTGAAT--TGATA-AGCTGA-GGTTCTGTGAGG-AATG P_troglodytes300460 GTCAGATGAT--TTGAAT--TGATA-AGCTGA-TGTTCTGTGAGG-TACA P_pygmaeus300364 TTCAGATTTT--TTGAAT--TGACA-AGCTGA-GGTTCTGTGACA-AATG P_pygmaeus300532 GTCAGATGAT--TTGAAT--TGATA-AGCTGA-TGTTCTGTGAGG-TACA P_pygmaeus300539 GTCAGATGAT--TTGAAT--TGATA-AGCTGA-TGTTCTGTGAGG-TACA R_norvegicus301097 GTCAGATGAT--TTGAAT--TGATACACTGAT-AACTCCGTGAAGGTGTG S_araneus300244 GTCAGATGAT--TTGAAT--CGATAATGCTGA-TCCTCTGTGAGG-TACA S_araneus300529 GTCAGGTGAT--TTGAAT--CGATAACGCTGA-CCCTCTGTGAGG-TACA S_tridecemlineatus300073 GTTAAATGAT--TTGAAT--TGATGA-GTTGA-TGCTCTGTAAGG-TATA S_tridecemlineatus300089 GTCAGCTGAC--TGGAAT--GAATA-AGCTGA-TGCTCTGTGAGG-CACA X_tropicalis300008 TCCAAATGATGACTGAAT---GAAG--TCTCGTTCGTCTGAAAATCTTTG * * * * C_familiaris300103 ACAAT---TAATAGCATGTTAGAGTTCTGATGACA D_novemcinctus300096 ACAGT---TAATAGCATGTTAGAGTTCTGATGACA E_caballus300032 ACAGT---TAATAGCATGTTAGAGTTCTGATGGCA E_europaeus300421 TA--------ATAGCATGTTAGAGTTCTGATGGCA F_catus300029 ACAAT---TAATAGCATGTTAGAGTTCTGATGGCA H_sapiens300166 AAAGT---TAATAGCATGTTAGAGTTCTGATGGCA M_mulatta300223 AAAAT---TAATAGCATGTTAGAGTTCTGATGGCA M_mulatta300276 ACAGT---TAAGAGCATATTAAAGTTGTTATGAAA M_murinus300392 ACAGT---TAATAGCATGTTAGAGTTCTGATGGCA M_domestica300070 CATTC---TTATAGCATGTTAGAGTTCTGATGGCA M_musculus300712 AATTT-----ATAGCATGTTAGAGTTCTGATGGCA O_anatinus302955 GATA----TCATAGCATGTTAGAGTTCTGATGGCA O_cuniculus300343 ACAGT---TAATAGCATGTTAGAGTTCTGATGGCA O_garnettii300161 ATAGT---TAATAGCATGCTAGAGTTCTGATGGCA O_garnettii300444 TCAGT---CAATTGCATGTTAGAGTTCTGATGGCA O_garnettii300731 TCAGT---TAATAGCATGGTAGAGTTCTGATGGAA P_troglodytes300189 ACAGT---TAAGAGCATGTTAAAGTTGTTATGAAA P_troglodytes300460 AAAGT---TAATAGCATGTTAGAGTTCTGATGGCA P_pygmaeus300364 ACAGT---TAAGAGCATGTTAAAGTTGTTATGAAA P_pygmaeus300532 AAAGT---TAATAGCATGTTAGAGTTCTGATGGCA P_pygmaeus300539 AAAGT---TAATAGCATGTTAGAGTTCTGATGGCA R_norvegicus301097 AATTTA--TTATAGCATGTTAGAGTTCTGATGGCA S_araneus300244 A-------TAATAGCATGTTAGAGTTCTGATGACG S_araneus300529 A-------TAATAGCATGTTAGAGTTCTGATGATG S_tridecemlineatus300073 ACAGT---TAATAGCATGTAAGAGTTCTGATGAAA S_tridecemlineatus300089 GAAGT---TAATAGCA-GCTGGAGTTCTGATGGCA X_tropicalis300008 AAGAATACTTTTAGCATGGTGGAGTTCTGATGGAG *** **** * ***

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved