snOPY snoRNA Orthological Gene Database

Family: SNORD27

CLUSTAL 2.0.10 multiple sequence alignment A_thaliana300154 ATTAATCCTTGTTGATAAACTCTAATCTTCTCTATGAGGCCTTTTTTCAATTACCTTTCA C_familiaris300102 ----------------------------ACTCTATGATGAACATA-----AAAAAAAGAC D_novemcinctus300097 ----------------------------TGTCCATGATGAATG-------TAAAAATGAC D_melanogaster300161 ----------------------------GTTCTGTGATGTCAA-------ACCAATAGAC D_melanogaster300167 ----------------------------TTTTTCTGATGACAA-------ACCAATAGAC D_melanogaster300169 ----------------------------TTTTCTTGATGA-AA-------ACC--TAGAC E_caballus300033 ----------------------------ACTCCATGATGAACGTA-----AAAA---GAC E_europaeus300420 ----------------------------ATTCCATGATGAATA-------TAAAAATGAC F_catus300030 ----------------------------ACTCTGTGATGAACATA-----AAAAA--GAC H_sapiens300167 ----------------------------ACTCCATGATGAACA--------CAAAATGAC M_mulatta300222 ----------------------------ACTCCGTGATGAACA--------CAAAATGAC M_murinus300393 ----------------------------ACTCCATGATGAACT--------CAAAATGAC M_musculus300711 ------------------------------TTAATGATGAAC--AA----TGTAAATGAC O_anatinus302956 ----------------------------TTTCCCTGATGAAGG-------TAAAAAAGAC O_cuniculus300342 ----------------------------ACTCCATGATGAACGAAC----GTAGAATGAC O_garnettii300572 ----------------------------ACTCCATGATGAACA--------CAAAATGAC P_troglodytes300461 ----------------------------ACTCCATGATGAACA--------CAAAATGAC P_pygmaeus300538 ----------------------------ACTCCATGATGAACA--------CAAAATGAC R_norvegicus301096 ----------------------------ACTTGATGATGAATGTAT----TATAAATGAC S_cerevisiae300015 ----------------------------TGCAGAAGATGAAACAAATTACTCAAATAGAC X_tropicalis300007 ----------------------------TGTCAATGATGAATA---------AAATAGAC ** * A_thaliana300154 AATCCGATTTCGTATTTATTTCTTTGGTTCTGTTTTTGGTTGATTTAGTGGCCTATGATT C_familiaris300102 AAGCATATGGCTGAACTT-AGAAGTGATGTCATCTT---ACTGCTGAGAAGT-------- D_novemcinctus300097 AAGCATATGACTGAAGTT-AAATATGATGTCATCTT---ACTCCTGAGAAG--------- D_melanogaster300161 AAGCATATAACCGAACAA-T--CATGTTGATT-TTCAC-ACGACTGAGC----------- D_melanogaster300167 AAGCATATACCTGAATTC-ACGTGTGTTGCTAACATTT-TTGACTGAAC----------- D_melanogaster300169 AAGCATATAGCTGAATTT-C--TCTGTCGACAACTCAC-GCGACTGATC----------- E_caballus300033 AAGCATATGACTGACCTC-AAAAGTGATGTCATCTT---CCTACTGAGAAGT-------- E_europaeus300420 AAGCATATGGCTGAATTT-AACGGTGATGTCGTTTTT--ACTGCTGAGATGT-------- F_catus300030 AAGCATATGGCTGATCTT-AAAAGTGATGTCATCTT---CCTGCTGAGAAGT-------- H_sapiens300167 AAGCATATGGCTGAACTT-TCAAGTGATGTCATCTT---ACTACTGAGAAGT-------- M_mulatta300222 AAGCATATGGCTGAACTT-ATAAGTGATGTCATCTT---ACTACTGAGAAGT-------- M_murinus300393 AAGCATATGACTGAACTT-AGAAGTGATGTCATCTT---ACTACTGAGAAGT-------- M_musculus300711 AAGCATATGGCTGAGTTG---CAATGATGTCATCTT---ACTACTGAAA----------- O_anatinus302956 AAGCATATGGCTGATGGC--ATAGTGATGTCACTTT---ACTTCTGAGAAA--------- O_cuniculus300342 AAGCATATGGCTGAACAA-GGAAGTGATGCCACATT---CCTACTGAGAAGT-------- O_garnettii300572 AAGCATATGACTGAACTT-AAAAGTGATGTCAACAT---ACTACTGAGAAGT-------- P_troglodytes300461 AAGCATATGGCTGAACTT-TCAAGTGATGTCATCTT---ACTACTGAGAAGT-------- P_pygmaeus300538 AAGCATATGGCTGAACTTATCAAGTGATGTCATCTT---ACTACTGAGAAGT-------- R_norvegicus301096 AAGCATATGGCTGAACTT---AGGTGATGTCATCTT---ACTGCTGAAAAGT-------- S_cerevisiae300015 AAGCATATGTCTGATCTTCATGATTGAAAAGAGCAATTAGTGTCTGATGCAATTTA---- X_tropicalis300007 AAGCATATGTCTGAATAG--TATGTGTTGCCATCTTATTTTTTCTGAGAAA--------- ** * ** * * ** * * A_thaliana300154 TAAATGATTATAGACAAGCATATGTCTGAATTAAT C_familiaris300102 ----------------------------------- D_novemcinctus300097 ----------------------------------- D_melanogaster300161 ----------------------------------- D_melanogaster300167 ----------------------------------- D_melanogaster300169 ----------------------------------- E_caballus300033 ----------------------------------- E_europaeus300420 ----------------------------------- F_catus300030 ----------------------------------- H_sapiens300167 ----------------------------------- M_mulatta300222 ----------------------------------- M_murinus300393 ----------------------------------- M_musculus300711 ----------------------------------- O_anatinus302956 ----------------------------------- O_cuniculus300342 ----------------------------------- O_garnettii300572 ----------------------------------- P_troglodytes300461 ----------------------------------- P_pygmaeus300538 ----------------------------------- R_norvegicus301096 ----------------------------------- S_cerevisiae300015 ----------------------------------- X_tropicalis300007 -----------------------------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved