snOPY snoRNA Orthological Gene Database

Family: SNORD26

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300101 CTACGGGGAT-GATACTAGGAATTGAACTCTCTCTTTCTGA-TGGGTTGG C_porcellus300619 CTGCAGGGAT-GAG-TGA-GAACTGAACTCTCTCTTTCTGA-TGGCTAAA D_rerio300176 CTACCATGAT-GACTTCA------GAATTCTCTCTTCCTGAATTGCT--T D_novemcinctus300098 CTACAGGGAT-GATCTTAGG-----AACTCTCTCTTTCCGA-TGGACTAG E_caballus300034 CTACGGGGAT-GATTTCAAGCACTGAACTCTCTCTTTCTGA-TGGCTTAG E_europaeus300026 TTGTGGGGAT-GATTTCCACAATTGAACTCTCTCTTTCTCA-TGGAGTAG E_europaeus300419 CTGCGGGGAT-GATTTCCACAATCGAACTCTCTCTTTCTGA-TGGCGTAG F_catus300031 CTACGGGGAT-GATACTAAGGATTGAACTCTCTCTTTCTGA-TGGAGTAG H_sapiens300168 CTACGGGGAT-GATTTTACGAACTGAACTCTCTCTTTCTGA-TGGATTAG M_mulatta300221 CTACGGGGAT-GATTTTACAAACTGAACTCTCTCTTTCTGA-TGGATTAG M_murinus300075 CTATGGGGAT-GATTTTAAGAATTGAACTCT----TTCTGA-TGGATTAG M_murinus300394 CTACGGTGAT-GATTTTAAGAATTGAACTCTCTCTTTCTGA-TGAATTAA M_domestica300071 CTACGAGGAT-GATTTGGACA-TGGAATTCTCTCTTGCTGA-TGGGTCAG M_musculus300710 CTACGGGGAT-GATAT-GAAAACTGAACTCTCTCTTTCTGA-TGGTTTAG M_lucifugus300217 CTACGGGGAT-GAT---AAAAACTGAACTCTCTCTTTCTGA-TGGATTGG M_lucifugus300499 CTACGGGGAT-GAT---AAAAACTGAACTCTCTCTTTCTGA-TGGATTGG O_cuniculus300341 CTACGGGGAT-GATTGCGACACTTGAACTCTCTCTTGCTGA-GGGGCTAG O_garnettii300104 --TCGGGAATAGATTTCAAGAGTTGAACTCTTTCTTTCTGA-TAGATTAG O_garnettii300571 CTACGGTGAT-GATTTTAAAAACTGAGCTCTCTCTTGCTGA-TGTGTTAG P_troglodytes300462 CTACGGGGAT-GATTTTACGAACTGAACTCTCTCTTTCTGA-TGGATTAG P_pygmaeus300537 CTACGGGGAT-GATTTTACGAACTGAACTCTCTCTTTCTGA-TGGATTAG R_norvegicus301095 CTACGGGGAT-GATTT-AGAAGCTGAACTCTCTCTTTCTGA-TGGTTTAG S_araneus300243 CTGCGGGGAT-GATTCTGACCCTTGAACTCTCTCTTGCTGA-TGGGCCAG S_tridecemlineatus300197 CTACAGGGAT-GAT-TTACGATTTGAACTCTCTCTTTCTGA-TGGTTTAG T_nigroviridis300124 CTGCTGTGAT-GAGACTA-----TGAACTCTCTCTTACTGAACTGGCTTT X_tropicalis300006 CTGCACTGAT-GATAAAAT-----GAACTCTCTCTTACTGAGTTTACAGT ** ** * *** * * * C_familiaris300101 TGGAGAAAATGT----AAAGATTCTGAGTAGC C_porcellus300619 TGGAGAAA------GCAAAAGTTCTGAGTAGC D_rerio300176 TGATGTAACTGTT-----CTAACCTGAGTAGC D_novemcinctus300098 TGGGGAAAACAT--TTAAAAATTCTGAGTAGC E_caballus300034 TGGAGAAAACGT----AAAAACTCTGAGTAGC E_europaeus300026 TG-AGAGATT-AT-AATACATT-CTGAGTAGA E_europaeus300419 TGGAGAGATCCGT-AGGACATTTCTGAGTAGC F_catus300031 TGGAGAAAGC----CTAAGAGTTCTGAGTAGC H_sapiens300168 TGGAGAAAACA-----GAAAATTCTGAGTAGC M_mulatta300221 TGGAGAAAACA------AAAATTCTGAGTAGC M_murinus300075 TAGAGAAAAC-----ACAAATT-CTGAGTAGC M_murinus300394 TGGAGAAAGCAC---AAAAAATTCTGAGTAGC M_domestica300071 TGGAGAAAGCTA--T--GACGTCCTGAGTAGC M_musculus300710 TGGAGAAAACA----AAAATTCTCTGAGTAGC M_lucifugus300217 TGGAGAAGTGTA-----TACATTCTGAGTAGC M_lucifugus300499 TGGAGAAGTGTA-----TACATTCTGAGTAGA O_cuniculus300341 TGGAGAAAATGC------AAATTCTGAGCAGC O_garnettii300104 TGGAGAAATC-----ACAAAATTCTGAGTGGC O_garnettii300571 TGGAGAAAGCGT---AAAAA-TTCTGAGTAGT P_troglodytes300462 TGGAGAAAACAC---AGAAAATTCTGAGTAGC P_pygmaeus300537 TGGAGAAAACAC---AAAAAATTCTGAGTAGC R_norvegicus301095 TGGAGAAATCA----AAAATACTCTGAGTAGC S_araneus300243 TGGAGAAAAATC--CTCAAAGTTCTGAGTGGC S_tridecemlineatus300197 TGGAGAAAAT----GTAAAAGTTCTGAGTAGC T_nigroviridis300124 TGAAGAAACCTCTTTACCAGATTCTGAGCGGA X_tropicalis300006 GGAGACAGACCTT-----ATAATCTGAGTAGC ***** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved